FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640695_at:

>probe:Drosophila_2:1640695_at:655:527; Interrogation_Position=1006; Antisense; GGGACCACTGCGAATAGTTAGCTAC
>probe:Drosophila_2:1640695_at:621:705; Interrogation_Position=1023; Antisense; TTAGCTACGCTCTGCACAAGTACTT
>probe:Drosophila_2:1640695_at:274:657; Interrogation_Position=1081; Antisense; TAAGGCCAAGGCCACATCGCAAGTG
>probe:Drosophila_2:1640695_at:239:219; Interrogation_Position=1112; Antisense; AAGTGAAATCTCTCTTGTCCCGCTG
>probe:Drosophila_2:1640695_at:569:663; Interrogation_Position=1141; Antisense; TAAAGTATTCCCAAGTGCCCATAAT
>probe:Drosophila_2:1640695_at:352:327; Interrogation_Position=1197; Antisense; GCGATTGTTTTGCATGGTTAGCCTA
>probe:Drosophila_2:1640695_at:621:701; Interrogation_Position=1294; Antisense; TTATTGCCGTGCTAGGGTTTTAACT
>probe:Drosophila_2:1640695_at:503:643; Interrogation_Position=1334; Antisense; TCTAGACTAGATGACGTGTGCTCGT
>probe:Drosophila_2:1640695_at:277:467; Interrogation_Position=1362; Antisense; GTTGGTGTGTGCTTCGTTTTAACAA
>probe:Drosophila_2:1640695_at:469:525; Interrogation_Position=895; Antisense; GGGAAAATTCACCTCAACTGTTGGA
>probe:Drosophila_2:1640695_at:694:173; Interrogation_Position=924; Antisense; AAAGCTGGCTGATCACCACTTTGGG
>probe:Drosophila_2:1640695_at:38:589; Interrogation_Position=949; Antisense; TGGAGCATTGCTTCCTTGGGATGGC
>probe:Drosophila_2:1640695_at:508:727; Interrogation_Position=964; Antisense; TTGGGATGGCTTCTTCACCAATCTT
>probe:Drosophila_2:1640695_at:662:353; Interrogation_Position=991; Antisense; GCACGCCATAGTTTTGGGACCACTG

Paste this into a BLAST search page for me
GGGACCACTGCGAATAGTTAGCTACTTAGCTACGCTCTGCACAAGTACTTTAAGGCCAAGGCCACATCGCAAGTGAAGTGAAATCTCTCTTGTCCCGCTGTAAAGTATTCCCAAGTGCCCATAATGCGATTGTTTTGCATGGTTAGCCTATTATTGCCGTGCTAGGGTTTTAACTTCTAGACTAGATGACGTGTGCTCGTGTTGGTGTGTGCTTCGTTTTAACAAGGGAAAATTCACCTCAACTGTTGGAAAAGCTGGCTGATCACCACTTTGGGTGGAGCATTGCTTCCTTGGGATGGCTTGGGATGGCTTCTTCACCAATCTTGCACGCCATAGTTTTGGGACCACTG

Full Affymetrix probeset data:

Annotations for 1640695_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720