FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640696_at:

>probe:Drosophila_2:1640696_at:508:625; Interrogation_Position=1018; Antisense; TGCCAGATGAAATTCGCTGACCCAT
>probe:Drosophila_2:1640696_at:450:609; Interrogation_Position=1035; Antisense; TGACCCATCTGCCATGAAACGACAT
>probe:Drosophila_2:1640696_at:452:207; Interrogation_Position=1061; Antisense; AAGCTTTGCACGACAAGTTTCCCAT
>probe:Drosophila_2:1640696_at:634:9; Interrogation_Position=1084; Antisense; ATTCGCTGTGACATCTGCCTAAAGG
>probe:Drosophila_2:1640696_at:305:627; Interrogation_Position=1099; Antisense; TGCCTAAAGGGATTCCTGCTGCGCT
>probe:Drosophila_2:1640696_at:333:369; Interrogation_Position=1157; Antisense; GAATGCATCCTCATCGGTGCGAGAT
>probe:Drosophila_2:1640696_at:172:327; Interrogation_Position=1175; Antisense; GCGAGATCTGCGATGTTCACTACCG
>probe:Drosophila_2:1640696_at:136:295; Interrogation_Position=1185; Antisense; CGATGTTCACTACCGCCATAGATAT
>probe:Drosophila_2:1640696_at:389:367; Interrogation_Position=1327; Antisense; GAATCTCAAACACCAATGCAGCCAA
>probe:Drosophila_2:1640696_at:101:177; Interrogation_Position=822; Antisense; AAACGCAAGCAGTCGTCACAGGCAC
>probe:Drosophila_2:1640696_at:375:603; Interrogation_Position=855; Antisense; TGTTCACGGAGCAGGCAATCGGATT
>probe:Drosophila_2:1640696_at:236:237; Interrogation_Position=871; Antisense; AATCGGATTCGAACGCGGGTGAAAT
>probe:Drosophila_2:1640696_at:144:373; Interrogation_Position=901; Antisense; GAAGAGGGATCCAGTCGCCATTACT
>probe:Drosophila_2:1640696_at:198:79; Interrogation_Position=960; Antisense; AGGTCTAGTCCTGCACATGAACTTC

Paste this into a BLAST search page for me
TGCCAGATGAAATTCGCTGACCCATTGACCCATCTGCCATGAAACGACATAAGCTTTGCACGACAAGTTTCCCATATTCGCTGTGACATCTGCCTAAAGGTGCCTAAAGGGATTCCTGCTGCGCTGAATGCATCCTCATCGGTGCGAGATGCGAGATCTGCGATGTTCACTACCGCGATGTTCACTACCGCCATAGATATGAATCTCAAACACCAATGCAGCCAAAAACGCAAGCAGTCGTCACAGGCACTGTTCACGGAGCAGGCAATCGGATTAATCGGATTCGAACGCGGGTGAAATGAAGAGGGATCCAGTCGCCATTACTAGGTCTAGTCCTGCACATGAACTTC

Full Affymetrix probeset data:

Annotations for 1640696_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720