Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640698_at:

>probe:Drosophila_2:1640698_at:362:547; Interrogation_Position=1348; Antisense; GGATGCTTCAGTCCAATCCGCAGCG
>probe:Drosophila_2:1640698_at:406:171; Interrogation_Position=1389; Antisense; AAAGCTATACTTGCGGAGGGCGGAA
>probe:Drosophila_2:1640698_at:649:699; Interrogation_Position=1429; Antisense; TTTTATCTTCGGTTACGGGCACGAG
>probe:Drosophila_2:1640698_at:299:707; Interrogation_Position=1441; Antisense; TTACGGGCACGAGCTTGGTCTTTAG
>probe:Drosophila_2:1640698_at:520:589; Interrogation_Position=1456; Antisense; TGGTCTTTAGCTTTCTTCTATCCTA
>probe:Drosophila_2:1640698_at:214:393; Interrogation_Position=1481; Antisense; GAAAGCGCTTCAGTTATTGTACAGA
>probe:Drosophila_2:1640698_at:70:265; Interrogation_Position=1502; Antisense; CAGAGTTGGCCTTATTTATACCTTA
>probe:Drosophila_2:1640698_at:217:541; Interrogation_Position=1538; Antisense; GGTTATCCAGTTGCAATATCTCTAC
>probe:Drosophila_2:1640698_at:660:17; Interrogation_Position=1606; Antisense; ATTTCGTACACACAAATCGCGACCT
>probe:Drosophila_2:1640698_at:114:167; Interrogation_Position=1619; Antisense; AAATCGCGACCTTTTTGTCACATTC
>probe:Drosophila_2:1640698_at:490:599; Interrogation_Position=1634; Antisense; TGTCACATTCCCCATCTGATTTAGT
>probe:Drosophila_2:1640698_at:536:565; Interrogation_Position=1677; Antisense; GGCAATTTTGTCCAGCAGAAGGCGA
>probe:Drosophila_2:1640698_at:537:325; Interrogation_Position=1698; Antisense; GCGAGTTTTAGCCACCTGAAAGCGC
>probe:Drosophila_2:1640698_at:320:391; Interrogation_Position=1715; Antisense; GAAAGCGCCGATCTACTGAAAATAC

Paste this into a BLAST search page for me
GGATGCTTCAGTCCAATCCGCAGCGAAAGCTATACTTGCGGAGGGCGGAATTTTATCTTCGGTTACGGGCACGAGTTACGGGCACGAGCTTGGTCTTTAGTGGTCTTTAGCTTTCTTCTATCCTAGAAAGCGCTTCAGTTATTGTACAGACAGAGTTGGCCTTATTTATACCTTAGGTTATCCAGTTGCAATATCTCTACATTTCGTACACACAAATCGCGACCTAAATCGCGACCTTTTTGTCACATTCTGTCACATTCCCCATCTGATTTAGTGGCAATTTTGTCCAGCAGAAGGCGAGCGAGTTTTAGCCACCTGAAAGCGCGAAAGCGCCGATCTACTGAAAATAC

Full Affymetrix probeset data:

Annotations for 1640698_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime