Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640699_at:

>probe:Drosophila_2:1640699_at:51:399; Interrogation_Position=112; Antisense; GACACAGAGCTGAACATCTTCCTGG
>probe:Drosophila_2:1640699_at:371:69; Interrogation_Position=13; Antisense; ATGGCCGACATCTTCACGACACTGC
>probe:Drosophila_2:1640699_at:644:255; Interrogation_Position=138; Antisense; CAGCCAGTACCAACGTAACGATCCG
>probe:Drosophila_2:1640699_at:459:491; Interrogation_Position=152; Antisense; GTAACGATCCGGAATTCTTTGCCCA
>probe:Drosophila_2:1640699_at:445:47; Interrogation_Position=158; Antisense; ATCCGGAATTCTTTGCCCAAGTGCA
>probe:Drosophila_2:1640699_at:329:165; Interrogation_Position=182; Antisense; AAATCAATCTGCACGATGGCATCGA
>probe:Drosophila_2:1640699_at:687:439; Interrogation_Position=196; Antisense; GATGGCATCGAAAGCGCCATTCTGA
>probe:Drosophila_2:1640699_at:143:607; Interrogation_Position=218; Antisense; TGAGGCGCCAGGGAAACCAGATTTC
>probe:Drosophila_2:1640699_at:699:125; Interrogation_Position=233; Antisense; ACCAGATTTCGCTGCTCGCTTGGAT
>probe:Drosophila_2:1640699_at:304:727; Interrogation_Position=252; Antisense; TTGGATCCTCACCAAACCGATGAAC
>probe:Drosophila_2:1640699_at:121:399; Interrogation_Position=30; Antisense; GACACTGCCGAAACGTCGGTTGGTA
>probe:Drosophila_2:1640699_at:427:589; Interrogation_Position=50; Antisense; TGGTACCCAACCTACTTAAGTCCAT
>probe:Drosophila_2:1640699_at:603:225; Interrogation_Position=78; Antisense; AATGGTCCTGGAGCATACTAGCCGA
>probe:Drosophila_2:1640699_at:655:673; Interrogation_Position=96; Antisense; TAGCCGACCCATGACTGACACAGAG

Paste this into a BLAST search page for me
GACACAGAGCTGAACATCTTCCTGGATGGCCGACATCTTCACGACACTGCCAGCCAGTACCAACGTAACGATCCGGTAACGATCCGGAATTCTTTGCCCAATCCGGAATTCTTTGCCCAAGTGCAAAATCAATCTGCACGATGGCATCGAGATGGCATCGAAAGCGCCATTCTGATGAGGCGCCAGGGAAACCAGATTTCACCAGATTTCGCTGCTCGCTTGGATTTGGATCCTCACCAAACCGATGAACGACACTGCCGAAACGTCGGTTGGTATGGTACCCAACCTACTTAAGTCCATAATGGTCCTGGAGCATACTAGCCGATAGCCGACCCATGACTGACACAGAG

Full Affymetrix probeset data:

Annotations for 1640699_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime