Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640700_at:

>probe:Drosophila_2:1640700_at:35:619; Interrogation_Position=1017; Antisense; TGCAGACCAAAAAGCTTCTCCTGGA
>probe:Drosophila_2:1640700_at:385:341; Interrogation_Position=1030; Antisense; GCTTCTCCTGGACATGAACGTAGTG
>probe:Drosophila_2:1640700_at:389:485; Interrogation_Position=1049; Antisense; GTAGTGGACAACTAGCCCATCGACG
>probe:Drosophila_2:1640700_at:542:301; Interrogation_Position=1064; Antisense; CCCATCGACGATTGGAACGGCTTGT
>probe:Drosophila_2:1640700_at:534:141; Interrogation_Position=1080; Antisense; ACGGCTTGTGTTTGTAGGTGGATAA
>probe:Drosophila_2:1640700_at:678:19; Interrogation_Position=1229; Antisense; ATTTGGCCATTGCATGTTATTCTTA
>probe:Drosophila_2:1640700_at:37:175; Interrogation_Position=1300; Antisense; AAAGCGATCATTTCAGCTCGTAAAT
>probe:Drosophila_2:1640700_at:257:651; Interrogation_Position=1324; Antisense; TAAACTTCACCGTTACGCTTAGAGT
>probe:Drosophila_2:1640700_at:144:215; Interrogation_Position=777; Antisense; AAGAGGTCACTTCGATTTCGCTGCA
>probe:Drosophila_2:1640700_at:141:561; Interrogation_Position=802; Antisense; GGAACCCTTCTACGAGTACGTTGTG
>probe:Drosophila_2:1640700_at:726:379; Interrogation_Position=821; Antisense; GTTGTGGACAACTCGGACTCCGTGG
>probe:Drosophila_2:1640700_at:594:189; Interrogation_Position=887; Antisense; AACATGATTCCGCAGGACAGCGCCT
>probe:Drosophila_2:1640700_at:466:87; Interrogation_Position=921; Antisense; AGTCCACCACACAGCTGGACGAGAA
>probe:Drosophila_2:1640700_at:623:205; Interrogation_Position=998; Antisense; AAGCGGCGGCTCATTGATCTGCAGA

Paste this into a BLAST search page for me
TGCAGACCAAAAAGCTTCTCCTGGAGCTTCTCCTGGACATGAACGTAGTGGTAGTGGACAACTAGCCCATCGACGCCCATCGACGATTGGAACGGCTTGTACGGCTTGTGTTTGTAGGTGGATAAATTTGGCCATTGCATGTTATTCTTAAAAGCGATCATTTCAGCTCGTAAATTAAACTTCACCGTTACGCTTAGAGTAAGAGGTCACTTCGATTTCGCTGCAGGAACCCTTCTACGAGTACGTTGTGGTTGTGGACAACTCGGACTCCGTGGAACATGATTCCGCAGGACAGCGCCTAGTCCACCACACAGCTGGACGAGAAAAGCGGCGGCTCATTGATCTGCAGA

Full Affymetrix probeset data:

Annotations for 1640700_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime