FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640701_at:

>probe:Drosophila_2:1640701_at:499:723; Interrogation_Position=401; Antisense; TTGCATTTCCATGCTGTGCCGGGTG
>probe:Drosophila_2:1640701_at:335:505; Interrogation_Position=416; Antisense; GTGCCGGGTGCCACAATCTTTGGCG
>probe:Drosophila_2:1640701_at:704:277; Interrogation_Position=433; Antisense; CTTTGGCGGCATGGATTTCACTTCT
>probe:Drosophila_2:1640701_at:249:17; Interrogation_Position=447; Antisense; ATTTCACTTCTTCGCTGGCACAAAA
>probe:Drosophila_2:1640701_at:277:177; Interrogation_Position=468; Antisense; AAAAGCGGCTGAGGGAAGCGTTACA
>probe:Drosophila_2:1640701_at:163:393; Interrogation_Position=498; Antisense; GAAAGGTCAACTGCGTGCTGTCCGA
>probe:Drosophila_2:1640701_at:525:621; Interrogation_Position=513; Antisense; TGCTGTCCGATATGGCACCCAATGC
>probe:Drosophila_2:1640701_at:71:261; Interrogation_Position=528; Antisense; CACCCAATGCCACCGGAGTGAGGAT
>probe:Drosophila_2:1640701_at:238:77; Interrogation_Position=561; Antisense; AGGAGAGCATCACTAACCTCTGCTA
>probe:Drosophila_2:1640701_at:418:269; Interrogation_Position=623; Antisense; CAGGCCCATCTGGTGGTCAAGGTGT
>probe:Drosophila_2:1640701_at:192:33; Interrogation_Position=651; Antisense; ATAATGGCGACGTGCCCAAGCTGGA
>probe:Drosophila_2:1640701_at:545:375; Interrogation_Position=706; Antisense; GAAGAGAGTAAAACCGCGCGCTAGC
>probe:Drosophila_2:1640701_at:204:143; Interrogation_Position=800; Antisense; ACTGCGTTTTTTGGACTAGTTGAAT
>probe:Drosophila_2:1640701_at:125:491; Interrogation_Position=879; Antisense; GTAACCTAGGATTAATTTCATCTCA

Paste this into a BLAST search page for me
TTGCATTTCCATGCTGTGCCGGGTGGTGCCGGGTGCCACAATCTTTGGCGCTTTGGCGGCATGGATTTCACTTCTATTTCACTTCTTCGCTGGCACAAAAAAAAGCGGCTGAGGGAAGCGTTACAGAAAGGTCAACTGCGTGCTGTCCGATGCTGTCCGATATGGCACCCAATGCCACCCAATGCCACCGGAGTGAGGATAGGAGAGCATCACTAACCTCTGCTACAGGCCCATCTGGTGGTCAAGGTGTATAATGGCGACGTGCCCAAGCTGGAGAAGAGAGTAAAACCGCGCGCTAGCACTGCGTTTTTTGGACTAGTTGAATGTAACCTAGGATTAATTTCATCTCA

Full Affymetrix probeset data:

Annotations for 1640701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720