FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640702_at:

>probe:Drosophila_2:1640702_at:272:339; Interrogation_Position=3958; Antisense; GCTAAGAACGTTGACATTAAGCATG
>probe:Drosophila_2:1640702_at:674:467; Interrogation_Position=3967; Antisense; GTTGACATTAAGCATGGAAGATCCA
>probe:Drosophila_2:1640702_at:451:563; Interrogation_Position=3982; Antisense; GGAAGATCCAATACCAAGACGGCCT
>probe:Drosophila_2:1640702_at:548:95; Interrogation_Position=3985; Antisense; AGATCCAATACCAAGACGGCCTCTT
>probe:Drosophila_2:1640702_at:68:629; Interrogation_Position=3988; Antisense; TCCAATACCAAGACGGCCTCTTCAA
>probe:Drosophila_2:1640702_at:353:235; Interrogation_Position=3996; Antisense; CAAGACGGCCTCTTCAACGCTTAAA
>probe:Drosophila_2:1640702_at:365:405; Interrogation_Position=3999; Antisense; GACGGCCTCTTCAACGCTTAAAAAT
>probe:Drosophila_2:1640702_at:619:313; Interrogation_Position=4003; Antisense; GCCTCTTCAACGCTTAAAAATTTAG
>probe:Drosophila_2:1640702_at:495:15; Interrogation_Position=4022; Antisense; ATTTAGTTCACCCTCGCTTTACTGG
>probe:Drosophila_2:1640702_at:600:215; Interrogation_Position=4024; Antisense; TTAGTTCACCCTCGCTTTACTGGAG
>probe:Drosophila_2:1640702_at:315:473; Interrogation_Position=4027; Antisense; GTTCACCCTCGCTTTACTGGAGTAA
>probe:Drosophila_2:1640702_at:627:649; Interrogation_Position=4029; Antisense; TCACCCTCGCTTTACTGGAGTAACG
>probe:Drosophila_2:1640702_at:110:1; Interrogation_Position=4032; Antisense; CCCTCGCTTTACTGGAGTAACGGAT
>probe:Drosophila_2:1640702_at:231:431; Interrogation_Position=4046; Antisense; GAGTAACGGATAAAGGGAACACCTG

Paste this into a BLAST search page for me
GCTAAGAACGTTGACATTAAGCATGGTTGACATTAAGCATGGAAGATCCAGGAAGATCCAATACCAAGACGGCCTAGATCCAATACCAAGACGGCCTCTTTCCAATACCAAGACGGCCTCTTCAACAAGACGGCCTCTTCAACGCTTAAAGACGGCCTCTTCAACGCTTAAAAATGCCTCTTCAACGCTTAAAAATTTAGATTTAGTTCACCCTCGCTTTACTGGTTAGTTCACCCTCGCTTTACTGGAGGTTCACCCTCGCTTTACTGGAGTAATCACCCTCGCTTTACTGGAGTAACGCCCTCGCTTTACTGGAGTAACGGATGAGTAACGGATAAAGGGAACACCTG

Full Affymetrix probeset data:

Annotations for 1640702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720