FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640703_at:

>probe:Drosophila_2:1640703_at:364:251; Interrogation_Position=4809; Antisense; CAAGATGGCCAGCTGCATGATCGAT
>probe:Drosophila_2:1640703_at:171:629; Interrogation_Position=4837; Antisense; TCCACGCAGGCACACACTGATTATG
>probe:Drosophila_2:1640703_at:73:117; Interrogation_Position=4852; Antisense; ACTGATTATGGCACCCTGAAGGCTC
>probe:Drosophila_2:1640703_at:622:291; Interrogation_Position=4882; Antisense; CGTCTCTTTGCACCCGAATGTGGAA
>probe:Drosophila_2:1640703_at:276:87; Interrogation_Position=4928; Antisense; AGTCGTACAGTAGCGGATCCGAACA
>probe:Drosophila_2:1640703_at:714:45; Interrogation_Position=4944; Antisense; ATCCGAACACTCTTTTGCAACCAAT
>probe:Drosophila_2:1640703_at:405:661; Interrogation_Position=5181; Antisense; TAAAATCCCAGCATCAACAGGTTAC
>probe:Drosophila_2:1640703_at:451:185; Interrogation_Position=5218; Antisense; AACAATGTACCGATGACACCCACAA
>probe:Drosophila_2:1640703_at:374:261; Interrogation_Position=5234; Antisense; CACCCACAACGTCAGAGAACTCATT
>probe:Drosophila_2:1640703_at:285:7; Interrogation_Position=5256; Antisense; ATTGATGAGCACCTCGTCCATGAGC
>probe:Drosophila_2:1640703_at:92:15; Interrogation_Position=5297; Antisense; ATTACTGCTACGAATGTGGCTCCAA
>probe:Drosophila_2:1640703_at:69:629; Interrogation_Position=5317; Antisense; TCCAAGTTCATATTCGAGACCGCCA
>probe:Drosophila_2:1640703_at:393:425; Interrogation_Position=5332; Antisense; GAGACCGCCAAGTTCTGCATGGATT
>probe:Drosophila_2:1640703_at:693:331; Interrogation_Position=5357; Antisense; GCGGCTTGAGACGTGCTGAACTTTA

Paste this into a BLAST search page for me
CAAGATGGCCAGCTGCATGATCGATTCCACGCAGGCACACACTGATTATGACTGATTATGGCACCCTGAAGGCTCCGTCTCTTTGCACCCGAATGTGGAAAGTCGTACAGTAGCGGATCCGAACAATCCGAACACTCTTTTGCAACCAATTAAAATCCCAGCATCAACAGGTTACAACAATGTACCGATGACACCCACAACACCCACAACGTCAGAGAACTCATTATTGATGAGCACCTCGTCCATGAGCATTACTGCTACGAATGTGGCTCCAATCCAAGTTCATATTCGAGACCGCCAGAGACCGCCAAGTTCTGCATGGATTGCGGCTTGAGACGTGCTGAACTTTA

Full Affymetrix probeset data:

Annotations for 1640703_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720