FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640705_at:

>probe:Drosophila_2:1640705_at:457:189; Interrogation_Position=1045; Antisense; AACTATTATACGTCTTCCGTCGTGG
>probe:Drosophila_2:1640705_at:60:595; Interrogation_Position=1067; Antisense; TGGGCGGATTGCTTAGTTCTTCAGA
>probe:Drosophila_2:1640705_at:85:93; Interrogation_Position=1081; Antisense; AGTTCTTCAGATCAGGGTCCCTCTA
>probe:Drosophila_2:1640705_at:277:531; Interrogation_Position=1095; Antisense; GGGTCCCTCTACAGTCGACGAAATA
>probe:Drosophila_2:1640705_at:653:409; Interrogation_Position=1111; Antisense; GACGAAATAACTGCAAGCCCCTTGA
>probe:Drosophila_2:1640705_at:312:77; Interrogation_Position=1271; Antisense; AGGATGCTGTCCCATATCTCAAAGC
>probe:Drosophila_2:1640705_at:295:287; Interrogation_Position=1296; Antisense; CGGCGGATTTGCTTTTCATTGCGAA
>probe:Drosophila_2:1640705_at:401:411; Interrogation_Position=1327; Antisense; GACGCTTATCCGGTGATTTCAGAAT
>probe:Drosophila_2:1640705_at:548:451; Interrogation_Position=1368; Antisense; GATCTGTGATCTGCGTGAAGTCTCC
>probe:Drosophila_2:1640705_at:217:107; Interrogation_Position=1433; Antisense; AGAACAGCCAGTATACCGAGATTTT
>probe:Drosophila_2:1640705_at:67:157; Interrogation_Position=1462; Antisense; ACAGCTATGTGTAATGCCCAGGAAA
>probe:Drosophila_2:1640705_at:706:691; Interrogation_Position=1492; Antisense; TTTGTAGAGCGCATTCTTCGACGGC
>probe:Drosophila_2:1640705_at:34:175; Interrogation_Position=1527; Antisense; AAAGCCAGCCTGTCAATCATTATAC
>probe:Drosophila_2:1640705_at:207:685; Interrogation_Position=1547; Antisense; TATACACCGTTTACCCTGTAAGCTT

Paste this into a BLAST search page for me
AACTATTATACGTCTTCCGTCGTGGTGGGCGGATTGCTTAGTTCTTCAGAAGTTCTTCAGATCAGGGTCCCTCTAGGGTCCCTCTACAGTCGACGAAATAGACGAAATAACTGCAAGCCCCTTGAAGGATGCTGTCCCATATCTCAAAGCCGGCGGATTTGCTTTTCATTGCGAAGACGCTTATCCGGTGATTTCAGAATGATCTGTGATCTGCGTGAAGTCTCCAGAACAGCCAGTATACCGAGATTTTACAGCTATGTGTAATGCCCAGGAAATTTGTAGAGCGCATTCTTCGACGGCAAAGCCAGCCTGTCAATCATTATACTATACACCGTTTACCCTGTAAGCTT

Full Affymetrix probeset data:

Annotations for 1640705_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720