FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640707_at:

>probe:Drosophila_2:1640707_at:210:371; Interrogation_Position=1057; Antisense; GAAGGCTACTGCATAAATCCGAACG
>probe:Drosophila_2:1640707_at:583:679; Interrogation_Position=1104; Antisense; TAGGACGCACTAGAGCGCAACCGAT
>probe:Drosophila_2:1640707_at:118:329; Interrogation_Position=1162; Antisense; GCGTTAATGTCCCTGCATAGCGAAA
>probe:Drosophila_2:1640707_at:647:25; Interrogation_Position=1178; Antisense; ATAGCGAAATCTACTGTGCCTTCTC
>probe:Drosophila_2:1640707_at:529:179; Interrogation_Position=1204; Antisense; AAAAACTCCAGATCCTTCTGCATTC
>probe:Drosophila_2:1640707_at:623:279; Interrogation_Position=1260; Antisense; CTCCGACTCCTCAAATGTATCTGTA
>probe:Drosophila_2:1640707_at:43:161; Interrogation_Position=1287; Antisense; ACAAGCGACGTGTAGGACCCAAAAT
>probe:Drosophila_2:1640707_at:727:625; Interrogation_Position=784; Antisense; TGCCGATCCACATGAGCGTTACAGA
>probe:Drosophila_2:1640707_at:432:585; Interrogation_Position=819; Antisense; TGGAAGCAAATGTTCGACCTGGCCA
>probe:Drosophila_2:1640707_at:448:579; Interrogation_Position=839; Antisense; GGCCATGCTGGATATACGGCGTTTT
>probe:Drosophila_2:1640707_at:90:141; Interrogation_Position=854; Antisense; ACGGCGTTTTGCGTACTACACCGAT
>probe:Drosophila_2:1640707_at:687:445; Interrogation_Position=894; Antisense; GATGCGGGCGTCTTTAACCGGATCA
>probe:Drosophila_2:1640707_at:506:201; Interrogation_Position=909; Antisense; AACCGGATCACCTTTGAGCAGCGAT
>probe:Drosophila_2:1640707_at:725:525; Interrogation_Position=958; Antisense; GGGAATTGATGCACGTTACTGGATA

Paste this into a BLAST search page for me
GAAGGCTACTGCATAAATCCGAACGTAGGACGCACTAGAGCGCAACCGATGCGTTAATGTCCCTGCATAGCGAAAATAGCGAAATCTACTGTGCCTTCTCAAAAACTCCAGATCCTTCTGCATTCCTCCGACTCCTCAAATGTATCTGTAACAAGCGACGTGTAGGACCCAAAATTGCCGATCCACATGAGCGTTACAGATGGAAGCAAATGTTCGACCTGGCCAGGCCATGCTGGATATACGGCGTTTTACGGCGTTTTGCGTACTACACCGATGATGCGGGCGTCTTTAACCGGATCAAACCGGATCACCTTTGAGCAGCGATGGGAATTGATGCACGTTACTGGATA

Full Affymetrix probeset data:

Annotations for 1640707_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720