FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640710_at:

>probe:Drosophila_2:1640710_at:664:631; Interrogation_Position=1029; Antisense; TCCGGGTCGCTTGGACAGGAAGATC
>probe:Drosophila_2:1640710_at:638:395; Interrogation_Position=1087; Antisense; GAAATTCTCAAGATTCACGCACTGA
>probe:Drosophila_2:1640710_at:98:405; Interrogation_Position=1135; Antisense; GACTACGAGGCCATTGTCAAGCTGT
>probe:Drosophila_2:1640710_at:124:501; Interrogation_Position=1158; Antisense; GTCGGACAACTTTAATGGCGCTGAT
>probe:Drosophila_2:1640710_at:669:323; Interrogation_Position=1175; Antisense; GCGCTGATCTGCGTAATGTCTGCAC
>probe:Drosophila_2:1640710_at:455:61; Interrogation_Position=1190; Antisense; ATGTCTGCACGGAGGCGGGTCTCTT
>probe:Drosophila_2:1640710_at:318:645; Interrogation_Position=1211; Antisense; TCTTTGCCATTCGTGCGGAGCGGGA
>probe:Drosophila_2:1640710_at:213:547; Interrogation_Position=1233; Antisense; GGAGTACGTCATCCAGGAGGACTTC
>probe:Drosophila_2:1640710_at:629:289; Interrogation_Position=1265; Antisense; CGGTGCGCAAGGTGTCGGACAACAA
>probe:Drosophila_2:1640710_at:273:665; Interrogation_Position=1312; Antisense; TACAAGCCCGTCTAGGAGCCAGTGC
>probe:Drosophila_2:1640710_at:543:687; Interrogation_Position=1396; Antisense; TATATTATGCCCACAACGGGCCTGT
>probe:Drosophila_2:1640710_at:685:599; Interrogation_Position=1418; Antisense; TGTCACACAAAGTCCGTTGCTTCTT
>probe:Drosophila_2:1640710_at:535:469; Interrogation_Position=1433; Antisense; GTTGCTTCTTCTCCATATGCTAATT
>probe:Drosophila_2:1640710_at:292:99; Interrogation_Position=944; Antisense; AGATGGACGGCTTCGATTCGCTTGG

Paste this into a BLAST search page for me
TCCGGGTCGCTTGGACAGGAAGATCGAAATTCTCAAGATTCACGCACTGAGACTACGAGGCCATTGTCAAGCTGTGTCGGACAACTTTAATGGCGCTGATGCGCTGATCTGCGTAATGTCTGCACATGTCTGCACGGAGGCGGGTCTCTTTCTTTGCCATTCGTGCGGAGCGGGAGGAGTACGTCATCCAGGAGGACTTCCGGTGCGCAAGGTGTCGGACAACAATACAAGCCCGTCTAGGAGCCAGTGCTATATTATGCCCACAACGGGCCTGTTGTCACACAAAGTCCGTTGCTTCTTGTTGCTTCTTCTCCATATGCTAATTAGATGGACGGCTTCGATTCGCTTGG

Full Affymetrix probeset data:

Annotations for 1640710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720