FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640711_at:

>probe:Drosophila_2:1640711_at:635:649; Interrogation_Position=1041; Antisense; TCAGCAAAGCTTACGTCACGGGATT
>probe:Drosophila_2:1640711_at:225:205; Interrogation_Position=1097; Antisense; AAGCCGCTTACCGTGGTCAATGGAT
>probe:Drosophila_2:1640711_at:60:227; Interrogation_Position=1115; Antisense; AATGGATCCCGCGTGGGATTCGGAC
>probe:Drosophila_2:1640711_at:403:537; Interrogation_Position=1211; Antisense; GGTCTGCTTTTTACCAGCTGCGGAT
>probe:Drosophila_2:1640711_at:533:485; Interrogation_Position=1240; Antisense; GTAGCCCGCAGGTGGTTCCTATAAA
>probe:Drosophila_2:1640711_at:47:685; Interrogation_Position=791; Antisense; TATCTCAAAGATGCCCGACCACTGG
>probe:Drosophila_2:1640711_at:228:349; Interrogation_Position=816; Antisense; GCAGGTTTGTGGTCCAGCTGTACAC
>probe:Drosophila_2:1640711_at:359:599; Interrogation_Position=834; Antisense; TGTACACAGAGGCTGCTCCGCTGGT
>probe:Drosophila_2:1640711_at:506:333; Interrogation_Position=868; Antisense; GCTGATCAAGTCCTGCATGTGCAAT
>probe:Drosophila_2:1640711_at:651:677; Interrogation_Position=907; Antisense; TATGGTCAAACGACTGTTCCCCAAT
>probe:Drosophila_2:1640711_at:410:603; Interrogation_Position=921; Antisense; TGTTCCCCAATCTCTGGCTGGAAAC
>probe:Drosophila_2:1640711_at:26:461; Interrogation_Position=947; Antisense; GATTTGATGCTGTCGTCGGACTCGC
>probe:Drosophila_2:1640711_at:228:127; Interrogation_Position=978; Antisense; ACCAGCCATTGGAGTACGACGCCAA
>probe:Drosophila_2:1640711_at:403:135; Interrogation_Position=993; Antisense; ACGACGCCAAAGTTATTGACCACGG

Paste this into a BLAST search page for me
TCAGCAAAGCTTACGTCACGGGATTAAGCCGCTTACCGTGGTCAATGGATAATGGATCCCGCGTGGGATTCGGACGGTCTGCTTTTTACCAGCTGCGGATGTAGCCCGCAGGTGGTTCCTATAAATATCTCAAAGATGCCCGACCACTGGGCAGGTTTGTGGTCCAGCTGTACACTGTACACAGAGGCTGCTCCGCTGGTGCTGATCAAGTCCTGCATGTGCAATTATGGTCAAACGACTGTTCCCCAATTGTTCCCCAATCTCTGGCTGGAAACGATTTGATGCTGTCGTCGGACTCGCACCAGCCATTGGAGTACGACGCCAAACGACGCCAAAGTTATTGACCACGG

Full Affymetrix probeset data:

Annotations for 1640711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720