Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640713_at:

>probe:Drosophila_2:1640713_at:282:171; Interrogation_Position=247; Antisense; AAAGTCACCATCTTCAACACCGAAA
>probe:Drosophila_2:1640713_at:248:295; Interrogation_Position=267; Antisense; CGAAACGGATCTGGGCCTTATGGTC
>probe:Drosophila_2:1640713_at:612:681; Interrogation_Position=285; Antisense; TATGGTCACCGGCTACAGCCAGTAC
>probe:Drosophila_2:1640713_at:208:187; Interrogation_Position=322; Antisense; AACAACGACATGGTCCTCATTGGCC
>probe:Drosophila_2:1640713_at:685:449; Interrogation_Position=365; Antisense; GATCGGTTCTGTCCTGGAACGTCAA
>probe:Drosophila_2:1640713_at:191:449; Interrogation_Position=447; Antisense; GATCGACGTGCTTATCATTGGCATT
>probe:Drosophila_2:1640713_at:549:3; Interrogation_Position=463; Antisense; ATTGGCATTGGCGACCAAGCACCGC
>probe:Drosophila_2:1640713_at:569:195; Interrogation_Position=538; Antisense; AACGTAGAGATCCTGCGCACGGAGC
>probe:Drosophila_2:1640713_at:658:551; Interrogation_Position=558; Antisense; GGAGCAGGCATGTGCCACCTTCAAC
>probe:Drosophila_2:1640713_at:619:651; Interrogation_Position=578; Antisense; TCAACTTCCTGAATGCCGAGAACCG
>probe:Drosophila_2:1640713_at:428:423; Interrogation_Position=595; Antisense; GAGAACCGAATGGTGGCCTGCGCCC
>probe:Drosophila_2:1640713_at:582:615; Interrogation_Position=632; Antisense; TGCACCTGTCCTACAACGAGAACGA
>probe:Drosophila_2:1640713_at:560:381; Interrogation_Position=651; Antisense; GAACGACATTCTGCAAGCGAAGCTG
>probe:Drosophila_2:1640713_at:173:211; Interrogation_Position=679; Antisense; AAGAAGGAGCTCTACGAGACCGAAT

Paste this into a BLAST search page for me
AAAGTCACCATCTTCAACACCGAAACGAAACGGATCTGGGCCTTATGGTCTATGGTCACCGGCTACAGCCAGTACAACAACGACATGGTCCTCATTGGCCGATCGGTTCTGTCCTGGAACGTCAAGATCGACGTGCTTATCATTGGCATTATTGGCATTGGCGACCAAGCACCGCAACGTAGAGATCCTGCGCACGGAGCGGAGCAGGCATGTGCCACCTTCAACTCAACTTCCTGAATGCCGAGAACCGGAGAACCGAATGGTGGCCTGCGCCCTGCACCTGTCCTACAACGAGAACGAGAACGACATTCTGCAAGCGAAGCTGAAGAAGGAGCTCTACGAGACCGAAT

Full Affymetrix probeset data:

Annotations for 1640713_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime