FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640714_at:

>probe:Drosophila_2:1640714_at:353:589; Interrogation_Position=2897; Antisense; TGGTATTGCCACAGGGATCCAGAAT
>probe:Drosophila_2:1640714_at:218:29; Interrogation_Position=2982; Antisense; ATAAAGGGAGGCTCGCCGGCATGTT
>probe:Drosophila_2:1640714_at:19:61; Interrogation_Position=3002; Antisense; ATGTTCTTCACCCAAAAAGTCGCCG
>probe:Drosophila_2:1640714_at:711:319; Interrogation_Position=3023; Antisense; GCCGCGTGAGCTTCTCCGGGAAAAG
>probe:Drosophila_2:1640714_at:547:33; Interrogation_Position=3063; Antisense; ATCAAGATCCTTGGTGGTTCCGAGG
>probe:Drosophila_2:1640714_at:31:283; Interrogation_Position=3146; Antisense; CTGCGACAGTCGATGCTTTTCTAAC
>probe:Drosophila_2:1640714_at:644:619; Interrogation_Position=3159; Antisense; TGCTTTTCTAACCATCTATCGCGAT
>probe:Drosophila_2:1640714_at:35:685; Interrogation_Position=3175; Antisense; TATCGCGATTCTTAAGTCAGCTCTC
>probe:Drosophila_2:1640714_at:92:709; Interrogation_Position=3186; Antisense; TTAAGTCAGCTCTCGTTCTCTATAA
>probe:Drosophila_2:1640714_at:349:471; Interrogation_Position=3200; Antisense; GTTCTCTATAATTCCAGATGCGGCA
>probe:Drosophila_2:1640714_at:567:237; Interrogation_Position=3247; Antisense; AATCTTCCCACATAATCGACATCAC
>probe:Drosophila_2:1640714_at:184:285; Interrogation_Position=3294; Antisense; CTGAAACTGCATATCGGGCTGGATT
>probe:Drosophila_2:1640714_at:221:235; Interrogation_Position=3323; Antisense; AATGCCTGGACGCATATGCCCAATA
>probe:Drosophila_2:1640714_at:575:291; Interrogation_Position=3403; Antisense; CGTTTTGGCCTTCGAGTGATTTTCA

Paste this into a BLAST search page for me
TGGTATTGCCACAGGGATCCAGAATATAAAGGGAGGCTCGCCGGCATGTTATGTTCTTCACCCAAAAAGTCGCCGGCCGCGTGAGCTTCTCCGGGAAAAGATCAAGATCCTTGGTGGTTCCGAGGCTGCGACAGTCGATGCTTTTCTAACTGCTTTTCTAACCATCTATCGCGATTATCGCGATTCTTAAGTCAGCTCTCTTAAGTCAGCTCTCGTTCTCTATAAGTTCTCTATAATTCCAGATGCGGCAAATCTTCCCACATAATCGACATCACCTGAAACTGCATATCGGGCTGGATTAATGCCTGGACGCATATGCCCAATACGTTTTGGCCTTCGAGTGATTTTCA

Full Affymetrix probeset data:

Annotations for 1640714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720