FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640715_at:

>probe:Drosophila_2:1640715_at:591:567; Interrogation_Position=229; Antisense; GGCACTACTAGAGGAGTCTCGCAAA
>probe:Drosophila_2:1640715_at:69:555; Interrogation_Position=260; Antisense; GGAGCGCTCCGCAAAGACTTTGAGG
>probe:Drosophila_2:1640715_at:405:519; Interrogation_Position=320; Antisense; GTGGTCCAGTTGGAGCAGTCGCTCA
>probe:Drosophila_2:1640715_at:388:209; Interrogation_Position=344; Antisense; AAGCAGTCCGTCATGCTGGGCGGCA
>probe:Drosophila_2:1640715_at:503:155; Interrogation_Position=368; Antisense; ACAGATGCTCCCAAATCACGACAAG
>probe:Drosophila_2:1640715_at:163:419; Interrogation_Position=401; Antisense; GAGCTGCTTCTAAAGGCCAAAACCC
>probe:Drosophila_2:1640715_at:229:311; Interrogation_Position=416; Antisense; GCCAAAACCCTGCTGTTCGAGAAGA
>probe:Drosophila_2:1640715_at:371:211; Interrogation_Position=542; Antisense; AAGACCGCCGAATGTGATCACACGC
>probe:Drosophila_2:1640715_at:112:35; Interrogation_Position=558; Antisense; ATCACACGCAGGCTCGTCTGGAGAA
>probe:Drosophila_2:1640715_at:392:107; Interrogation_Position=633; Antisense; AGAAACTAGCCATCTCCAAAGGAGT
>probe:Drosophila_2:1640715_at:288:393; Interrogation_Position=662; Antisense; GACAAGCTGCGTTCGGAGTACGACA
>probe:Drosophila_2:1640715_at:112:431; Interrogation_Position=677; Antisense; GAGTACGACACCCAGTCACAGATAT
>probe:Drosophila_2:1640715_at:579:77; Interrogation_Position=705; Antisense; AGGATCTTAAGTCCGCGTACGAGCA
>probe:Drosophila_2:1640715_at:584:73; Interrogation_Position=732; Antisense; AGGTCAAGGTTCTCACCAAGGCTTT

Paste this into a BLAST search page for me
GGCACTACTAGAGGAGTCTCGCAAAGGAGCGCTCCGCAAAGACTTTGAGGGTGGTCCAGTTGGAGCAGTCGCTCAAAGCAGTCCGTCATGCTGGGCGGCAACAGATGCTCCCAAATCACGACAAGGAGCTGCTTCTAAAGGCCAAAACCCGCCAAAACCCTGCTGTTCGAGAAGAAAGACCGCCGAATGTGATCACACGCATCACACGCAGGCTCGTCTGGAGAAAGAAACTAGCCATCTCCAAAGGAGTGACAAGCTGCGTTCGGAGTACGACAGAGTACGACACCCAGTCACAGATATAGGATCTTAAGTCCGCGTACGAGCAAGGTCAAGGTTCTCACCAAGGCTTT

Full Affymetrix probeset data:

Annotations for 1640715_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720