FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640716_at:

>probe:Drosophila_2:1640716_at:369:57; Interrogation_Position=13; Antisense; ATGATGAGTTCTCCCGTGCCAAGTT
>probe:Drosophila_2:1640716_at:446:107; Interrogation_Position=134; Antisense; AGAAGACTGTATCCGTTTCGCGATT
>probe:Drosophila_2:1640716_at:588:319; Interrogation_Position=161; Antisense; GCCGCGTCCATCGTGTCGCAGAGGA
>probe:Drosophila_2:1640716_at:106:349; Interrogation_Position=178; Antisense; GCAGAGGACCTGACCCGTGAATTGG
>probe:Drosophila_2:1640716_at:572:361; Interrogation_Position=196; Antisense; GAATTGGCCGGCATGTCGTTGAAAA
>probe:Drosophila_2:1640716_at:524:181; Interrogation_Position=218; Antisense; AAAAACAGGCTGTGCAACCGCGTCG
>probe:Drosophila_2:1640716_at:277:643; Interrogation_Position=22; Antisense; TCTCCCGTGCCAAGTTTTGCCAAGT
>probe:Drosophila_2:1640716_at:217:499; Interrogation_Position=239; Antisense; GTCGTCGTTATTCTTTCACCAATGA
>probe:Drosophila_2:1640716_at:716:3; Interrogation_Position=248; Antisense; ATTCTTTCACCAATGAGTTCCCGGA
>probe:Drosophila_2:1640716_at:317:87; Interrogation_Position=344; Antisense; AGTCCAATTTTGATATGTCCGTGCT
>probe:Drosophila_2:1640716_at:35:453; Interrogation_Position=472; Antisense; GATCTAAATATGACCAGTGGCTCCA
>probe:Drosophila_2:1640716_at:548:83; Interrogation_Position=487; Antisense; AGTGGCTCCATCAACCCAGCTACAT
>probe:Drosophila_2:1640716_at:91:377; Interrogation_Position=63; Antisense; GAAGACTACGACCTTTTCACGATTC
>probe:Drosophila_2:1640716_at:503:701; Interrogation_Position=76; Antisense; TTTTCACGATTCATCCGCACCGATC

Paste this into a BLAST search page for me
ATGATGAGTTCTCCCGTGCCAAGTTAGAAGACTGTATCCGTTTCGCGATTGCCGCGTCCATCGTGTCGCAGAGGAGCAGAGGACCTGACCCGTGAATTGGGAATTGGCCGGCATGTCGTTGAAAAAAAAACAGGCTGTGCAACCGCGTCGTCTCCCGTGCCAAGTTTTGCCAAGTGTCGTCGTTATTCTTTCACCAATGAATTCTTTCACCAATGAGTTCCCGGAAGTCCAATTTTGATATGTCCGTGCTGATCTAAATATGACCAGTGGCTCCAAGTGGCTCCATCAACCCAGCTACATGAAGACTACGACCTTTTCACGATTCTTTTCACGATTCATCCGCACCGATC

Full Affymetrix probeset data:

Annotations for 1640716_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720