FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640717_at:

>probe:Drosophila_2:1640717_at:674:549; Interrogation_Position=319; Antisense; GGAGATAGCTATCTCGACCCGTATC
>probe:Drosophila_2:1640717_at:696:111; Interrogation_Position=401; Antisense; AGCACAAGTGGCAATCTCCGGTTCC
>probe:Drosophila_2:1640717_at:434:541; Interrogation_Position=420; Antisense; GGTTCCTCCACTTGCGGAAGTCAAG
>probe:Drosophila_2:1640717_at:546:219; Interrogation_Position=442; Antisense; AAGGCTAAGAGGGATCCCGCCAACT
>probe:Drosophila_2:1640717_at:107:279; Interrogation_Position=510; Antisense; CTACACCTTGCCCTGGAAACGAAAG
>probe:Drosophila_2:1640717_at:487:435; Interrogation_Position=535; Antisense; GAGGTTCCGGACTCACTCCGATATA
>probe:Drosophila_2:1640717_at:62:23; Interrogation_Position=555; Antisense; ATATATGCCCTCGATCAGTGCTGGA
>probe:Drosophila_2:1640717_at:90:87; Interrogation_Position=571; Antisense; AGTGCTGGAGCCATGACCAATCTGG
>probe:Drosophila_2:1640717_at:717:289; Interrogation_Position=635; Antisense; CGGAGCAATCGCAACTGGGTGAGTC
>probe:Drosophila_2:1640717_at:73:411; Interrogation_Position=721; Antisense; GACGCTCCGGAGGATTCCGAGCAGA
>probe:Drosophila_2:1640717_at:726:375; Interrogation_Position=762; Antisense; GAAGACATCGAAGCTCCTGCAGGCC
>probe:Drosophila_2:1640717_at:553:97; Interrogation_Position=812; Antisense; AGATCCGATCGCTGGTGTCGCGCAA
>probe:Drosophila_2:1640717_at:399:265; Interrogation_Position=859; Antisense; CAGTTCATTGATCCCAGCTACATGT
>probe:Drosophila_2:1640717_at:635:279; Interrogation_Position=876; Antisense; CTACATGTGGCTGGGTCTGGGCAAA

Paste this into a BLAST search page for me
GGAGATAGCTATCTCGACCCGTATCAGCACAAGTGGCAATCTCCGGTTCCGGTTCCTCCACTTGCGGAAGTCAAGAAGGCTAAGAGGGATCCCGCCAACTCTACACCTTGCCCTGGAAACGAAAGGAGGTTCCGGACTCACTCCGATATAATATATGCCCTCGATCAGTGCTGGAAGTGCTGGAGCCATGACCAATCTGGCGGAGCAATCGCAACTGGGTGAGTCGACGCTCCGGAGGATTCCGAGCAGAGAAGACATCGAAGCTCCTGCAGGCCAGATCCGATCGCTGGTGTCGCGCAACAGTTCATTGATCCCAGCTACATGTCTACATGTGGCTGGGTCTGGGCAAA

Full Affymetrix probeset data:

Annotations for 1640717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720