FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640728_at:

>probe:Drosophila_2:1640728_at:661:347; Interrogation_Position=184; Antisense; GCAGTTTGACCGAGGCCCAGATTGA
>probe:Drosophila_2:1640728_at:85:547; Interrogation_Position=252; Antisense; GGATGGGTTTCCGTCCAACAGCTCG
>probe:Drosophila_2:1640728_at:701:233; Interrogation_Position=284; Antisense; AATGCGGGCCCTTGGAGAGAGTCTC
>probe:Drosophila_2:1640728_at:647:431; Interrogation_Position=302; Antisense; GAGTCTCACCGAGGCGGAGATCTAC
>probe:Drosophila_2:1640728_at:477:551; Interrogation_Position=317; Antisense; GGAGATCTACGACCTGGCCAACGAA
>probe:Drosophila_2:1640728_at:131:149; Interrogation_Position=352; Antisense; ACTTCGGTGGGCAGGTGCAGTTCAA
>probe:Drosophila_2:1640728_at:668:221; Interrogation_Position=375; Antisense; AAGGACTTTCTATACGTGATGAGCA
>probe:Drosophila_2:1640728_at:199:107; Interrogation_Position=415; Antisense; AGAACAGTCTGGTGTGCCTAAAGCA
>probe:Drosophila_2:1640728_at:230:661; Interrogation_Position=433; Antisense; TAAAGCAGGCCTTCAAAATCTTCGA
>probe:Drosophila_2:1640728_at:195:403; Interrogation_Position=537; Antisense; GACTTGCGCGAGTTGTTCCAGGACA
>probe:Drosophila_2:1640728_at:196:441; Interrogation_Position=576; Antisense; GATGGAAAGATCTCCTTCAACGAAT
>probe:Drosophila_2:1640728_at:23:201; Interrogation_Position=594; Antisense; AACGAATTTGTTACCGCCATGCGAA
>probe:Drosophila_2:1640728_at:144:679; Interrogation_Position=701; Antisense; TAGGCGGCACCACTTGAAATTCCCA
>probe:Drosophila_2:1640728_at:7:147; Interrogation_Position=729; Antisense; AAATTCCTTTGGCTTACTCAACGCA

Paste this into a BLAST search page for me
GCAGTTTGACCGAGGCCCAGATTGAGGATGGGTTTCCGTCCAACAGCTCGAATGCGGGCCCTTGGAGAGAGTCTCGAGTCTCACCGAGGCGGAGATCTACGGAGATCTACGACCTGGCCAACGAAACTTCGGTGGGCAGGTGCAGTTCAAAAGGACTTTCTATACGTGATGAGCAAGAACAGTCTGGTGTGCCTAAAGCATAAAGCAGGCCTTCAAAATCTTCGAGACTTGCGCGAGTTGTTCCAGGACAGATGGAAAGATCTCCTTCAACGAATAACGAATTTGTTACCGCCATGCGAATAGGCGGCACCACTTGAAATTCCCAAAATTCCTTTGGCTTACTCAACGCA

Full Affymetrix probeset data:

Annotations for 1640728_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720