FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640730_at:

>probe:Drosophila_2:1640730_at:637:441; Interrogation_Position=3959; Antisense; GATGGTGCACATCTCCAATCGAATA
>probe:Drosophila_2:1640730_at:124:237; Interrogation_Position=3975; Antisense; AATCGAATACCACTCGCCTGGCGAG
>probe:Drosophila_2:1640730_at:43:635; Interrogation_Position=3988; Antisense; TCGCCTGGCGAGAAATCCGCATGAA
>probe:Drosophila_2:1640730_at:74:397; Interrogation_Position=4021; Antisense; GACAACCAACCACTCGTAACTATAT
>probe:Drosophila_2:1640730_at:692:685; Interrogation_Position=4113; Antisense; TATCATTGTGAAATTGCTGCGAACT
>probe:Drosophila_2:1640730_at:485:335; Interrogation_Position=4128; Antisense; GCTGCGAACTGCATGAGTGTGTTAT
>probe:Drosophila_2:1640730_at:79:27; Interrogation_Position=4180; Antisense; ATACTTGTGTGCGTTTACATTTTAA
>probe:Drosophila_2:1640730_at:695:653; Interrogation_Position=4210; Antisense; TAATACGGAAGAGCGTTTCGAACGA
>probe:Drosophila_2:1640730_at:181:465; Interrogation_Position=4233; Antisense; GATTGATGGAACTGCATCGTCGATA
>probe:Drosophila_2:1640730_at:35:345; Interrogation_Position=4246; Antisense; GCATCGTCGATACATTTTACACAAA
>probe:Drosophila_2:1640730_at:304:689; Interrogation_Position=4273; Antisense; TATTCAGCATAGTCGGAATCGGAGA
>probe:Drosophila_2:1640730_at:370:135; Interrogation_Position=4378; Antisense; ACGAATGTGGAGGACGCAGCGAACA
>probe:Drosophila_2:1640730_at:138:555; Interrogation_Position=4389; Antisense; GGACGCAGCGAACATAAACGATTCA
>probe:Drosophila_2:1640730_at:586:489; Interrogation_Position=4452; Antisense; GTACTCTAGGCTACTGCAACTATAA

Paste this into a BLAST search page for me
GATGGTGCACATCTCCAATCGAATAAATCGAATACCACTCGCCTGGCGAGTCGCCTGGCGAGAAATCCGCATGAAGACAACCAACCACTCGTAACTATATTATCATTGTGAAATTGCTGCGAACTGCTGCGAACTGCATGAGTGTGTTATATACTTGTGTGCGTTTACATTTTAATAATACGGAAGAGCGTTTCGAACGAGATTGATGGAACTGCATCGTCGATAGCATCGTCGATACATTTTACACAAATATTCAGCATAGTCGGAATCGGAGAACGAATGTGGAGGACGCAGCGAACAGGACGCAGCGAACATAAACGATTCAGTACTCTAGGCTACTGCAACTATAA

Full Affymetrix probeset data:

Annotations for 1640730_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720