FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640733_at:

>probe:Drosophila_2:1640733_at:426:323; Interrogation_Position=121; Antisense; GCGACGTTTAATTTTCCCGAATATG
>probe:Drosophila_2:1640733_at:411:55; Interrogation_Position=13; Antisense; ATGACGCGTCCTGCGATTTTCCTCG
>probe:Drosophila_2:1640733_at:98:231; Interrogation_Position=166; Antisense; AATGAAATCACTTACCACGAACTGG
>probe:Drosophila_2:1640733_at:218:589; Interrogation_Position=188; Antisense; TGGAGGTGACCTGTGACCAGCACGC
>probe:Drosophila_2:1640733_at:220:319; Interrogation_Position=211; Antisense; GCCCAGTGCATTGGCCTTAGTCCGG
>probe:Drosophila_2:1640733_at:261:581; Interrogation_Position=242; Antisense; TGGCCAAGATCAACTGCATCCGACA
>probe:Drosophila_2:1640733_at:537:371; Interrogation_Position=263; Antisense; GACAGTGCATTTCGCCATCGTGCTA
>probe:Drosophila_2:1640733_at:238:315; Interrogation_Position=276; Antisense; GCCATCGTGCTACCAGGACATCTAT
>probe:Drosophila_2:1640733_at:689:15; Interrogation_Position=28; Antisense; ATTTTCCTCGTTGTCTGCTCAATAA
>probe:Drosophila_2:1640733_at:50:269; Interrogation_Position=289; Antisense; CAGGACATCTATGCCTTCAACGAGC
>probe:Drosophila_2:1640733_at:227:311; Interrogation_Position=334; Antisense; GCCAGGCTGAACTCCTTTAAGGGAT
>probe:Drosophila_2:1640733_at:146:727; Interrogation_Position=38; Antisense; TTGTCTGCTCAATAACTCTGCTTAA
>probe:Drosophila_2:1640733_at:405:281; Interrogation_Position=53; Antisense; CTCTGCTTAATTCCGTCAATGGCTA
>probe:Drosophila_2:1640733_at:332:65; Interrogation_Position=98; Antisense; ATGGCAAGCTGTTTCCGAAGGCGGC

Paste this into a BLAST search page for me
GCGACGTTTAATTTTCCCGAATATGATGACGCGTCCTGCGATTTTCCTCGAATGAAATCACTTACCACGAACTGGTGGAGGTGACCTGTGACCAGCACGCGCCCAGTGCATTGGCCTTAGTCCGGTGGCCAAGATCAACTGCATCCGACAGACAGTGCATTTCGCCATCGTGCTAGCCATCGTGCTACCAGGACATCTATATTTTCCTCGTTGTCTGCTCAATAACAGGACATCTATGCCTTCAACGAGCGCCAGGCTGAACTCCTTTAAGGGATTTGTCTGCTCAATAACTCTGCTTAACTCTGCTTAATTCCGTCAATGGCTAATGGCAAGCTGTTTCCGAAGGCGGC

Full Affymetrix probeset data:

Annotations for 1640733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720