Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640735_at:

>probe:Drosophila_2:1640735_at:265:393; Interrogation_Position=6737; Antisense; GAAAGACCCGCAGTGCAGGCTTGAA
>probe:Drosophila_2:1640735_at:600:71; Interrogation_Position=6753; Antisense; AGGCTTGAACCATCCGAGCGATGCA
>probe:Drosophila_2:1640735_at:483:445; Interrogation_Position=6772; Antisense; GATGCACACGAAGACGATCTGCTGG
>probe:Drosophila_2:1640735_at:400:587; Interrogation_Position=6956; Antisense; TGGAGGAGGCCGATCATTTGCTGTC
>probe:Drosophila_2:1640735_at:707:19; Interrogation_Position=6971; Antisense; ATTTGCTGTCCTACCACAGTAGCAG
>probe:Drosophila_2:1640735_at:309:155; Interrogation_Position=6986; Antisense; ACAGTAGCAGCAGTGCCGCGGATGT
>probe:Drosophila_2:1640735_at:424:283; Interrogation_Position=7027; Antisense; CTGATGCCGGAGCTGGACAATGCCA
>probe:Drosophila_2:1640735_at:392:321; Interrogation_Position=7064; Antisense; GCGCCAGCTTTGTCGACTACGATGA
>probe:Drosophila_2:1640735_at:477:671; Interrogation_Position=7081; Antisense; TACGATGAGTTCAATCTGTGCCTGA
>probe:Drosophila_2:1640735_at:679:237; Interrogation_Position=7093; Antisense; AATCTGTGCCTGAACAACATCCTCA
>probe:Drosophila_2:1640735_at:364:209; Interrogation_Position=7180; Antisense; AAGCACCAACAGTCATGGCGCGATG
>probe:Drosophila_2:1640735_at:325:327; Interrogation_Position=7199; Antisense; GCGATGCCGGCGACGTACTCAACAT
>probe:Drosophila_2:1640735_at:105:491; Interrogation_Position=7225; Antisense; GTACAGCTCAGCAACGATTTGGGAT
>probe:Drosophila_2:1640735_at:606:429; Interrogation_Position=7251; Antisense; GAGTTTTCAGGAGTTCGCCAGCGAG

Paste this into a BLAST search page for me
GAAAGACCCGCAGTGCAGGCTTGAAAGGCTTGAACCATCCGAGCGATGCAGATGCACACGAAGACGATCTGCTGGTGGAGGAGGCCGATCATTTGCTGTCATTTGCTGTCCTACCACAGTAGCAGACAGTAGCAGCAGTGCCGCGGATGTCTGATGCCGGAGCTGGACAATGCCAGCGCCAGCTTTGTCGACTACGATGATACGATGAGTTCAATCTGTGCCTGAAATCTGTGCCTGAACAACATCCTCAAAGCACCAACAGTCATGGCGCGATGGCGATGCCGGCGACGTACTCAACATGTACAGCTCAGCAACGATTTGGGATGAGTTTTCAGGAGTTCGCCAGCGAG

Full Affymetrix probeset data:

Annotations for 1640735_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime