Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640736_at:

>probe:Drosophila_2:1640736_at:108:331; Interrogation_Position=1517; Antisense; GCGGATGTCTTCAAGTTCTGGTTCA
>probe:Drosophila_2:1640736_at:258:71; Interrogation_Position=1572; Antisense; AGGCGCATGTCGAGAAGGTCTTCCG
>probe:Drosophila_2:1640736_at:118:425; Interrogation_Position=1655; Antisense; GAGAGTCCCGAGTGCACCAACATTA
>probe:Drosophila_2:1640736_at:384:151; Interrogation_Position=1674; Antisense; ACATTAGCTTCTGGTATGTGCCGCC
>probe:Drosophila_2:1640736_at:377:229; Interrogation_Position=1711; Antisense; AATGGAGCGCAATCGCGAGTTCTAC
>probe:Drosophila_2:1640736_at:269:93; Interrogation_Position=1728; Antisense; AGTTCTACGACCGTCTGCATAAGGT
>probe:Drosophila_2:1640736_at:235:525; Interrogation_Position=1786; Antisense; GGGCTCCATGATGATCACGTACCAG
>probe:Drosophila_2:1640736_at:675:191; Interrogation_Position=1829; Antisense; AACTTCTTTCGCCTGGTGCTGCAGA
>probe:Drosophila_2:1640736_at:617:619; Interrogation_Position=1845; Antisense; TGCTGCAGAACTCCTGCCTGGAGGA
>probe:Drosophila_2:1640736_at:283:401; Interrogation_Position=1874; Antisense; GACATGGTCTACTTTCTGGACGAGA
>probe:Drosophila_2:1640736_at:384:367; Interrogation_Position=1901; Antisense; GAATCGCTCGCCCAAAACTTGTAAA
>probe:Drosophila_2:1640736_at:461:189; Interrogation_Position=1916; Antisense; AACTTGTAAACGGTGACGCGGCGAT
>probe:Drosophila_2:1640736_at:624:157; Interrogation_Position=1965; Antisense; ACAACATTCTCTTTAGGCTTACGCC
>probe:Drosophila_2:1640736_at:253:569; Interrogation_Position=1980; Antisense; GGCTTACGCCGATTGTATCTTCTAG

Paste this into a BLAST search page for me
GCGGATGTCTTCAAGTTCTGGTTCAAGGCGCATGTCGAGAAGGTCTTCCGGAGAGTCCCGAGTGCACCAACATTAACATTAGCTTCTGGTATGTGCCGCCAATGGAGCGCAATCGCGAGTTCTACAGTTCTACGACCGTCTGCATAAGGTGGGCTCCATGATGATCACGTACCAGAACTTCTTTCGCCTGGTGCTGCAGATGCTGCAGAACTCCTGCCTGGAGGAGACATGGTCTACTTTCTGGACGAGAGAATCGCTCGCCCAAAACTTGTAAAAACTTGTAAACGGTGACGCGGCGATACAACATTCTCTTTAGGCTTACGCCGGCTTACGCCGATTGTATCTTCTAG

Full Affymetrix probeset data:

Annotations for 1640736_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime