Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640738_a_at:

>probe:Drosophila_2:1640738_a_at:592:489; Interrogation_Position=1020; Antisense; GTAAAGGCGAAACCCGCATCTGCAA
>probe:Drosophila_2:1640738_a_at:220:347; Interrogation_Position=1035; Antisense; GCATCTGCAAGATCTACGACTCGCC
>probe:Drosophila_2:1640738_a_at:645:719; Interrogation_Position=1064; Antisense; TTGCCGGAATCGGAGGCCATGTTCG
>probe:Drosophila_2:1640738_a_at:233:417; Interrogation_Position=1166; Antisense; GAGCTCCCTAACTTTCTAATGATTA
>probe:Drosophila_2:1640738_a_at:672:181; Interrogation_Position=1279; Antisense; AAAACAGCCGTTGCGAATTGTATGT
>probe:Drosophila_2:1640738_a_at:65:209; Interrogation_Position=713; Antisense; AAGCTCATCCAGATGGCGGCGGGCA
>probe:Drosophila_2:1640738_a_at:100:291; Interrogation_Position=732; Antisense; CGGGCATGCTCTTTGAGTCCAGATA
>probe:Drosophila_2:1640738_a_at:121:97; Interrogation_Position=752; Antisense; AGATACGCTTTGCTGATTGTGGACA
>probe:Drosophila_2:1640738_a_at:255:559; Interrogation_Position=772; Antisense; GGACAGTGCCATGGCGCTCTACAGA
>probe:Drosophila_2:1640738_a_at:467:203; Interrogation_Position=836; Antisense; AACCATTTGGGCTTATTTCTGCGCA
>probe:Drosophila_2:1640738_a_at:209:53; Interrogation_Position=860; Antisense; ATGCTTCAACGCCTGGCCGATGAGT
>probe:Drosophila_2:1640738_a_at:235:669; Interrogation_Position=904; Antisense; TACTAACCAGGTTACTGCCTCGCTG
>probe:Drosophila_2:1640738_a_at:301:355; Interrogation_Position=935; Antisense; GCACCCGGCATGTTTGATGCCAAGA
>probe:Drosophila_2:1640738_a_at:289:211; Interrogation_Position=956; Antisense; AAGAAGCCCATTGGCGGGCACATCA

Paste this into a BLAST search page for me
GTAAAGGCGAAACCCGCATCTGCAAGCATCTGCAAGATCTACGACTCGCCTTGCCGGAATCGGAGGCCATGTTCGGAGCTCCCTAACTTTCTAATGATTAAAAACAGCCGTTGCGAATTGTATGTAAGCTCATCCAGATGGCGGCGGGCACGGGCATGCTCTTTGAGTCCAGATAAGATACGCTTTGCTGATTGTGGACAGGACAGTGCCATGGCGCTCTACAGAAACCATTTGGGCTTATTTCTGCGCAATGCTTCAACGCCTGGCCGATGAGTTACTAACCAGGTTACTGCCTCGCTGGCACCCGGCATGTTTGATGCCAAGAAAGAAGCCCATTGGCGGGCACATCA

Full Affymetrix probeset data:

Annotations for 1640738_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime