Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640740_a_at:

>probe:Drosophila_2:1640740_a_at:681:689; Interrogation_Position=271; Antisense; TATTGCGCTGATATACTACTCCTCT
>probe:Drosophila_2:1640740_a_at:344:17; Interrogation_Position=322; Antisense; ATTTCCGCATTGGTTCTTTTGACTG
>probe:Drosophila_2:1640740_a_at:242:333; Interrogation_Position=336; Antisense; TCTTTTGACTGCACTTTTTCGGGAA
>probe:Drosophila_2:1640740_a_at:504:561; Interrogation_Position=357; Antisense; GGAAAATCCGCATTTGCTGCCAGTT
>probe:Drosophila_2:1640740_a_at:468:93; Interrogation_Position=378; Antisense; AGTTCATCTGGTGACTTCTCTTTGT
>probe:Drosophila_2:1640740_a_at:528:643; Interrogation_Position=394; Antisense; TCTCTTTGTGGCCTGATGCTCGAAA
>probe:Drosophila_2:1640740_a_at:414:239; Interrogation_Position=424; Antisense; AATCACATGGTGATTGCCTCCCTTG
>probe:Drosophila_2:1640740_a_at:132:633; Interrogation_Position=442; Antisense; TCCCTTGGCAGAACCGATTACGTTT
>probe:Drosophila_2:1640740_a_at:348:139; Interrogation_Position=513; Antisense; ACGTCGTGATCGTGCTGAGCTACTA
>probe:Drosophila_2:1640740_a_at:536:703; Interrogation_Position=550; Antisense; TTAGTGAACCACTCCGATTACCCAT
>probe:Drosophila_2:1640740_a_at:301:413; Interrogation_Position=589; Antisense; GACCGGGCGCAGCATGTAGCATTTT
>probe:Drosophila_2:1640740_a_at:431:235; Interrogation_Position=659; Antisense; AATCCGCGCCGTGCATAAATCGTGG
>probe:Drosophila_2:1640740_a_at:570:165; Interrogation_Position=675; Antisense; AAATCGTGGCCAATTGTCACCAGCG
>probe:Drosophila_2:1640740_a_at:666:201; Interrogation_Position=712; Antisense; AACCTCAGCGACCTGCGTTTAATTA

Paste this into a BLAST search page for me
TATTGCGCTGATATACTACTCCTCTATTTCCGCATTGGTTCTTTTGACTGTCTTTTGACTGCACTTTTTCGGGAAGGAAAATCCGCATTTGCTGCCAGTTAGTTCATCTGGTGACTTCTCTTTGTTCTCTTTGTGGCCTGATGCTCGAAAAATCACATGGTGATTGCCTCCCTTGTCCCTTGGCAGAACCGATTACGTTTACGTCGTGATCGTGCTGAGCTACTATTAGTGAACCACTCCGATTACCCATGACCGGGCGCAGCATGTAGCATTTTAATCCGCGCCGTGCATAAATCGTGGAAATCGTGGCCAATTGTCACCAGCGAACCTCAGCGACCTGCGTTTAATTA

Full Affymetrix probeset data:

Annotations for 1640740_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime