Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640743_at:

>probe:Drosophila_2:1640743_at:16:69; Interrogation_Position=1473; Antisense; ATGGCCTGGGCCACTTGATCGGTCT
>probe:Drosophila_2:1640743_at:629:605; Interrogation_Position=1488; Antisense; TGATCGGTCTGGATGTGCACGACGT
>probe:Drosophila_2:1640743_at:661:613; Interrogation_Position=1549; Antisense; TGAACCGTGGCTGAGCAAGCTGCGC
>probe:Drosophila_2:1640743_at:387:307; Interrogation_Position=1585; Antisense; CCTTAAGGCCGGCATGTATGTCACA
>probe:Drosophila_2:1640743_at:311:61; Interrogation_Position=1598; Antisense; ATGTATGTCACAATCGAACCCGGCT
>probe:Drosophila_2:1640743_at:352:287; Interrogation_Position=1655; Antisense; CTGGCCGATCCGAACATTGCTAAAT
>probe:Drosophila_2:1640743_at:679:101; Interrogation_Position=1690; Antisense; AGAGATGTTCAATCGCTTCCGGAAT
>probe:Drosophila_2:1640743_at:456:295; Interrogation_Position=1708; Antisense; CCGGAATTTCGGAGGTGTGCGCATC
>probe:Drosophila_2:1640743_at:67:63; Interrogation_Position=1740; Antisense; ATGTGCTCATCACGAAGACTGGCGT
>probe:Drosophila_2:1640743_at:96:407; Interrogation_Position=1756; Antisense; GACTGGCGTGGAGAACTTTGCGATT
>probe:Drosophila_2:1640743_at:105:191; Interrogation_Position=1769; Antisense; AACTTTGCGATTGTGCCGCGAACGG
>probe:Drosophila_2:1640743_at:587:557; Interrogation_Position=1798; Antisense; GGACATCGAGGCAACCATGACCTGT
>probe:Drosophila_2:1640743_at:74:605; Interrogation_Position=1828; Antisense; TGATTCGCCGGTTTAGAGCTTTTAA
>probe:Drosophila_2:1640743_at:674:417; Interrogation_Position=1843; Antisense; GAGCTTTTAAACTATATTCCACGCG

Paste this into a BLAST search page for me
ATGGCCTGGGCCACTTGATCGGTCTTGATCGGTCTGGATGTGCACGACGTTGAACCGTGGCTGAGCAAGCTGCGCCCTTAAGGCCGGCATGTATGTCACAATGTATGTCACAATCGAACCCGGCTCTGGCCGATCCGAACATTGCTAAATAGAGATGTTCAATCGCTTCCGGAATCCGGAATTTCGGAGGTGTGCGCATCATGTGCTCATCACGAAGACTGGCGTGACTGGCGTGGAGAACTTTGCGATTAACTTTGCGATTGTGCCGCGAACGGGGACATCGAGGCAACCATGACCTGTTGATTCGCCGGTTTAGAGCTTTTAAGAGCTTTTAAACTATATTCCACGCG

Full Affymetrix probeset data:

Annotations for 1640743_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime