FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640745_at:

>probe:Drosophila_2:1640745_at:650:277; Interrogation_Position=1019; Antisense; CTACGCTTGCTTTCGAGTGGCTAAA
>probe:Drosophila_2:1640745_at:452:319; Interrogation_Position=1059; Antisense; GCCGAAGAGTTTATCCTTGCCTTGA
>probe:Drosophila_2:1640745_at:592:621; Interrogation_Position=680; Antisense; TGCTGGCTCGAATTTGCAGGGCTAC
>probe:Drosophila_2:1640745_at:672:349; Interrogation_Position=695; Antisense; GCAGGGCTACATGTGGCATACTTTC
>probe:Drosophila_2:1640745_at:693:663; Interrogation_Position=713; Antisense; TACTTTCCATAAGATGTCCCCAGGG
>probe:Drosophila_2:1640745_at:598:451; Interrogation_Position=746; Antisense; GATCTCGCCAGGATTCGTTGATGTA
>probe:Drosophila_2:1640745_at:624:467; Interrogation_Position=762; Antisense; GTTGATGTAGGCTCTTATGCTCCAC
>probe:Drosophila_2:1640745_at:94:705; Interrogation_Position=776; Antisense; TTATGCTCCACTCGGCGGTTCAGCG
>probe:Drosophila_2:1640745_at:344:223; Interrogation_Position=811; Antisense; AAGGTCCTGCCACATGTCAGCAGGA
>probe:Drosophila_2:1640745_at:269:327; Interrogation_Position=830; Antisense; GCAGGAGGGATTACTTCGTTCGCGC
>probe:Drosophila_2:1640745_at:243:337; Interrogation_Position=861; Antisense; GCTGCCCACATTTCATTGTTTGTCA
>probe:Drosophila_2:1640745_at:425:495; Interrogation_Position=882; Antisense; GTCAGCATTTACATGTCCTTTTCCC
>probe:Drosophila_2:1640745_at:104:491; Interrogation_Position=909; Antisense; GTACACTCCTGCTGTGAATGTGTGT
>probe:Drosophila_2:1640745_at:352:517; Interrogation_Position=928; Antisense; GTGTGTGTTTTCATATGCTCCAAGT

Paste this into a BLAST search page for me
CTACGCTTGCTTTCGAGTGGCTAAAGCCGAAGAGTTTATCCTTGCCTTGATGCTGGCTCGAATTTGCAGGGCTACGCAGGGCTACATGTGGCATACTTTCTACTTTCCATAAGATGTCCCCAGGGGATCTCGCCAGGATTCGTTGATGTAGTTGATGTAGGCTCTTATGCTCCACTTATGCTCCACTCGGCGGTTCAGCGAAGGTCCTGCCACATGTCAGCAGGAGCAGGAGGGATTACTTCGTTCGCGCGCTGCCCACATTTCATTGTTTGTCAGTCAGCATTTACATGTCCTTTTCCCGTACACTCCTGCTGTGAATGTGTGTGTGTGTGTTTTCATATGCTCCAAGT

Full Affymetrix probeset data:

Annotations for 1640745_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720