FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640746_at:

>probe:Drosophila_2:1640746_at:184:339; Interrogation_Position=1050; Antisense; GCTAATACTCCACAAACATTCCTGC
>probe:Drosophila_2:1640746_at:496:253; Interrogation_Position=1062; Antisense; CAAACATTCCTGCATGTCGACAGAC
>probe:Drosophila_2:1640746_at:711:61; Interrogation_Position=1075; Antisense; ATGTCGACAGACTTTAGCCGTTGTC
>probe:Drosophila_2:1640746_at:668:389; Interrogation_Position=1137; Antisense; GAAACTTTATAATCTCCACACTCGA
>probe:Drosophila_2:1640746_at:596:491; Interrogation_Position=1175; Antisense; GTAAACACGTTGACACTGCTTTTGT
>probe:Drosophila_2:1640746_at:198:343; Interrogation_Position=1192; Antisense; GCTTTTGTCCTGTTTTATTATCTCT
>probe:Drosophila_2:1640746_at:278:15; Interrogation_Position=1208; Antisense; ATTATCTCTGGTTTATTCTTTGACA
>probe:Drosophila_2:1640746_at:161:193; Interrogation_Position=844; Antisense; AACTAGTGCGTTACCAATGGTGCAA
>probe:Drosophila_2:1640746_at:547:689; Interrogation_Position=922; Antisense; TATTCTGTGAACTTTACATTCCAGT
>probe:Drosophila_2:1640746_at:20:667; Interrogation_Position=936; Antisense; TACATTCCAGTCACATATTGCGTCC
>probe:Drosophila_2:1640746_at:395:691; Interrogation_Position=951; Antisense; TATTGCGTCCCGAACTCAAATCACA
>probe:Drosophila_2:1640746_at:358:165; Interrogation_Position=968; Antisense; AAATCACACCGAATTATGCCCTTGA
>probe:Drosophila_2:1640746_at:291:245; Interrogation_Position=979; Antisense; AATTATGCCCTTGATGGCGTTTCTT
>probe:Drosophila_2:1640746_at:390:581; Interrogation_Position=993; Antisense; TGGCGTTTCTTTATCGATTCGACAA

Paste this into a BLAST search page for me
GCTAATACTCCACAAACATTCCTGCCAAACATTCCTGCATGTCGACAGACATGTCGACAGACTTTAGCCGTTGTCGAAACTTTATAATCTCCACACTCGAGTAAACACGTTGACACTGCTTTTGTGCTTTTGTCCTGTTTTATTATCTCTATTATCTCTGGTTTATTCTTTGACAAACTAGTGCGTTACCAATGGTGCAATATTCTGTGAACTTTACATTCCAGTTACATTCCAGTCACATATTGCGTCCTATTGCGTCCCGAACTCAAATCACAAAATCACACCGAATTATGCCCTTGAAATTATGCCCTTGATGGCGTTTCTTTGGCGTTTCTTTATCGATTCGACAA

Full Affymetrix probeset data:

Annotations for 1640746_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720