Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640748_at:

>probe:Drosophila_2:1640748_at:440:513; Interrogation_Position=1018; Antisense; GTGATTCAATCTGGAATGTTCCGGA
>probe:Drosophila_2:1640748_at:303:191; Interrogation_Position=1080; Antisense; AACTTTCGAGAGACGCAACGGCGGA
>probe:Drosophila_2:1640748_at:357:139; Interrogation_Position=1097; Antisense; ACGGCGGACGTCAAACGAACACCTG
>probe:Drosophila_2:1640748_at:10:431; Interrogation_Position=1200; Antisense; GAGTTTCTGCAGTAAAGTGGATCGA
>probe:Drosophila_2:1640748_at:213:383; Interrogation_Position=1223; Antisense; GAACGAGCTGAATCTACCATATTGT
>probe:Drosophila_2:1640748_at:104:273; Interrogation_Position=1263; Antisense; CATTGCGTTTTTGGAATCGACCTTT
>probe:Drosophila_2:1640748_at:589:411; Interrogation_Position=1281; Antisense; GACCTTTCTTTGCTGGCTACTAAAA
>probe:Drosophila_2:1640748_at:680:443; Interrogation_Position=789; Antisense; GATGACGATCTGGAGTTCTTCGAGA
>probe:Drosophila_2:1640748_at:65:507; Interrogation_Position=824; Antisense; GTGCAGCGTGAATCTTAACAAGTCT
>probe:Drosophila_2:1640748_at:548:499; Interrogation_Position=845; Antisense; GTCTGAGCAGGAGCACATGGACGAA
>probe:Drosophila_2:1640748_at:200:411; Interrogation_Position=864; Antisense; GACGAAGACCTGTAGCGATAGCCAT
>probe:Drosophila_2:1640748_at:580:483; Interrogation_Position=918; Antisense; GTAGATTTGTATGTCCGTAACCGTA
>probe:Drosophila_2:1640748_at:638:483; Interrogation_Position=934; Antisense; GTAACCGTAAGAACCCAGTTGATAG
>probe:Drosophila_2:1640748_at:592:455; Interrogation_Position=954; Antisense; GATAGCATGCAAGAATACTCCGCCT

Paste this into a BLAST search page for me
GTGATTCAATCTGGAATGTTCCGGAAACTTTCGAGAGACGCAACGGCGGAACGGCGGACGTCAAACGAACACCTGGAGTTTCTGCAGTAAAGTGGATCGAGAACGAGCTGAATCTACCATATTGTCATTGCGTTTTTGGAATCGACCTTTGACCTTTCTTTGCTGGCTACTAAAAGATGACGATCTGGAGTTCTTCGAGAGTGCAGCGTGAATCTTAACAAGTCTGTCTGAGCAGGAGCACATGGACGAAGACGAAGACCTGTAGCGATAGCCATGTAGATTTGTATGTCCGTAACCGTAGTAACCGTAAGAACCCAGTTGATAGGATAGCATGCAAGAATACTCCGCCT

Full Affymetrix probeset data:

Annotations for 1640748_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime