Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640750_at:

>probe:Drosophila_2:1640750_at:164:255; Interrogation_Position=5542; Antisense; CAACTGCTGTTGATGGTGCGCGAGA
>probe:Drosophila_2:1640750_at:136:13; Interrogation_Position=5639; Antisense; ATTAGCCATGGCAGAGTAGCATCTA
>probe:Drosophila_2:1640750_at:543:485; Interrogation_Position=5654; Antisense; GTAGCATCTATGACAGTTGACAATT
>probe:Drosophila_2:1640750_at:559:395; Interrogation_Position=5672; Antisense; GACAATTACCCAAAGTCCTTCGATT
>probe:Drosophila_2:1640750_at:629:217; Interrogation_Position=5684; Antisense; AAGTCCTTCGATTTAGTCTAAGTAG
>probe:Drosophila_2:1640750_at:494:689; Interrogation_Position=5745; Antisense; TATTTATTACCCTGGTTGACCTAGC
>probe:Drosophila_2:1640750_at:186:301; Interrogation_Position=5754; Antisense; CCCTGGTTGACCTAGCATGCTTTAA
>probe:Drosophila_2:1640750_at:315:581; Interrogation_Position=5801; Antisense; TGGCCAGTATGGCAGCTTCATATAT
>probe:Drosophila_2:1640750_at:503:59; Interrogation_Position=5827; Antisense; ATGTAAATGGTTTGCTCTCGTTCCC
>probe:Drosophila_2:1640750_at:394:717; Interrogation_Position=5847; Antisense; TTCCCCTTCTTTTTAAGCGTATCTG
>probe:Drosophila_2:1640750_at:182:123; Interrogation_Position=5862; Antisense; AGCGTATCTGTATACTCTTTCTATA
>probe:Drosophila_2:1640750_at:618:269; Interrogation_Position=5882; Antisense; CTATAGGTGTAACGTCAAGTGCTTC
>probe:Drosophila_2:1640750_at:689:219; Interrogation_Position=5898; Antisense; AAGTGCTTCGTGTAATTTGCTCAAT
>probe:Drosophila_2:1640750_at:547:19; Interrogation_Position=5912; Antisense; ATTTGCTCAATTTTTGCGCTTTGTA

Paste this into a BLAST search page for me
CAACTGCTGTTGATGGTGCGCGAGAATTAGCCATGGCAGAGTAGCATCTAGTAGCATCTATGACAGTTGACAATTGACAATTACCCAAAGTCCTTCGATTAAGTCCTTCGATTTAGTCTAAGTAGTATTTATTACCCTGGTTGACCTAGCCCCTGGTTGACCTAGCATGCTTTAATGGCCAGTATGGCAGCTTCATATATATGTAAATGGTTTGCTCTCGTTCCCTTCCCCTTCTTTTTAAGCGTATCTGAGCGTATCTGTATACTCTTTCTATACTATAGGTGTAACGTCAAGTGCTTCAAGTGCTTCGTGTAATTTGCTCAATATTTGCTCAATTTTTGCGCTTTGTA

Full Affymetrix probeset data:

Annotations for 1640750_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime