Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640755_at:

>probe:Drosophila_2:1640755_at:390:327; Interrogation_Position=1196; Antisense; GCGTTACGTAGTTCCCGGTCATCCA
>probe:Drosophila_2:1640755_at:476:537; Interrogation_Position=1212; Antisense; GGTCATCCAAACTTCGTCATCGAGG
>probe:Drosophila_2:1640755_at:438:439; Interrogation_Position=1233; Antisense; GAGGCTGGTCAATCGGTCATCATAC
>probe:Drosophila_2:1640755_at:631:691; Interrogation_Position=1302; Antisense; TTTGAGTTCCGACCCGAGCGATTCT
>probe:Drosophila_2:1640755_at:378:375; Interrogation_Position=1332; Antisense; GAAGAATCGGCTGGTCGTCCCTCGG
>probe:Drosophila_2:1640755_at:85:627; Interrogation_Position=1366; Antisense; TGCCTTTTGGAGATGGTCCTCGGAA
>probe:Drosophila_2:1640755_at:492:639; Interrogation_Position=1385; Antisense; TCGGAACTGCATTGGCCTGAGATTC
>probe:Drosophila_2:1640755_at:595:53; Interrogation_Position=1416; Antisense; ATGCAGGCTCGCATTGGACTCGCTC
>probe:Drosophila_2:1640755_at:123:633; Interrogation_Position=1435; Antisense; TCGCTCTGCTCATCAGGAACTTTAA
>probe:Drosophila_2:1640755_at:587:697; Interrogation_Position=1455; Antisense; TTTAAGTTCTCCACGTGCTCGAAGA
>probe:Drosophila_2:1640755_at:103:343; Interrogation_Position=1475; Antisense; GAAGACGCCCAATCCTTTGGTCTAC
>probe:Drosophila_2:1640755_at:440:727; Interrogation_Position=1491; Antisense; TTGGTCTACGATCCCAAATCATTCG
>probe:Drosophila_2:1640755_at:107:631; Interrogation_Position=1671; Antisense; TCCTCATGGCCATTGATCTATCTTT
>probe:Drosophila_2:1640755_at:594:451; Interrogation_Position=1685; Antisense; GATCTATCTTTTGTTTATTGCCAGA

Paste this into a BLAST search page for me
GCGTTACGTAGTTCCCGGTCATCCAGGTCATCCAAACTTCGTCATCGAGGGAGGCTGGTCAATCGGTCATCATACTTTGAGTTCCGACCCGAGCGATTCTGAAGAATCGGCTGGTCGTCCCTCGGTGCCTTTTGGAGATGGTCCTCGGAATCGGAACTGCATTGGCCTGAGATTCATGCAGGCTCGCATTGGACTCGCTCTCGCTCTGCTCATCAGGAACTTTAATTTAAGTTCTCCACGTGCTCGAAGAGAAGACGCCCAATCCTTTGGTCTACTTGGTCTACGATCCCAAATCATTCGTCCTCATGGCCATTGATCTATCTTTGATCTATCTTTTGTTTATTGCCAGA

Full Affymetrix probeset data:

Annotations for 1640755_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime