Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640757_at:

>probe:Drosophila_2:1640757_at:666:401; Interrogation_Position=1323; Antisense; GACATCGGCATGCTGCGACTCGGAA
>probe:Drosophila_2:1640757_at:82:29; Interrogation_Position=1371; Antisense; ATACGTCCGATTTGCATTTTCGCAA
>probe:Drosophila_2:1640757_at:122:211; Interrogation_Position=1394; Antisense; AAGCAACCGTTTCCAGGAGCCGATA
>probe:Drosophila_2:1640757_at:237:135; Interrogation_Position=1437; Antisense; ACGACCACCGTTTGGCGTGAAACTG
>probe:Drosophila_2:1640757_at:521:507; Interrogation_Position=1453; Antisense; GTGAAACTGCCGCTAACGCAACGAG
>probe:Drosophila_2:1640757_at:71:425; Interrogation_Position=1518; Antisense; GAGACGTGCTCCGAAATCTATGGCT
>probe:Drosophila_2:1640757_at:325:683; Interrogation_Position=1547; Antisense; TATGACGTTCGAACAGATCTGCGCC
>probe:Drosophila_2:1640757_at:43:189; Interrogation_Position=1575; Antisense; AACACCTTGAGTCAACTCTGCAGCA
>probe:Drosophila_2:1640757_at:350:573; Interrogation_Position=1610; Antisense; GGCTCCGCAGATCCGCAAAATGTGG
>probe:Drosophila_2:1640757_at:426:521; Interrogation_Position=1631; Antisense; GTGGCACAATGGCTCAGACCGCTAT
>probe:Drosophila_2:1640757_at:611:103; Interrogation_Position=1646; Antisense; AGACCGCTATGTGCAACTGGGCATC
>probe:Drosophila_2:1640757_at:277:383; Interrogation_Position=1697; Antisense; GAACTCTGGCATTCTCATGGATCTA
>probe:Drosophila_2:1640757_at:606:269; Interrogation_Position=1712; Antisense; CATGGATCTATTGAGCTACGCTGAC
>probe:Drosophila_2:1640757_at:669:239; Interrogation_Position=1759; Antisense; AATACGGACCCTCGACGGATATGAA

Paste this into a BLAST search page for me
GACATCGGCATGCTGCGACTCGGAAATACGTCCGATTTGCATTTTCGCAAAAGCAACCGTTTCCAGGAGCCGATAACGACCACCGTTTGGCGTGAAACTGGTGAAACTGCCGCTAACGCAACGAGGAGACGTGCTCCGAAATCTATGGCTTATGACGTTCGAACAGATCTGCGCCAACACCTTGAGTCAACTCTGCAGCAGGCTCCGCAGATCCGCAAAATGTGGGTGGCACAATGGCTCAGACCGCTATAGACCGCTATGTGCAACTGGGCATCGAACTCTGGCATTCTCATGGATCTACATGGATCTATTGAGCTACGCTGACAATACGGACCCTCGACGGATATGAA

Full Affymetrix probeset data:

Annotations for 1640757_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime