FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640759_at:

>probe:Drosophila_2:1640759_at:285:1; Interrogation_Position=427; Antisense; ATGGACTTACTACAGGGAACAGGGA
>probe:Drosophila_2:1640759_at:503:265; Interrogation_Position=446; Antisense; CAGGGAACCAAATGCATTGTCAGTA
>probe:Drosophila_2:1640759_at:465:123; Interrogation_Position=483; Antisense; ACCAATGGGCGGTATTATTTAAGCT
>probe:Drosophila_2:1640759_at:418:241; Interrogation_Position=540; Antisense; AATATCGTTCAAAATCCCAGTCGGA
>probe:Drosophila_2:1640759_at:236:45; Interrogation_Position=553; Antisense; ATCCCAGTCGGAATGGTCAGAACCA
>probe:Drosophila_2:1640759_at:65:381; Interrogation_Position=572; Antisense; GAACCAACAGGTCGAAGACGGCAAT
>probe:Drosophila_2:1640759_at:229:605; Interrogation_Position=596; Antisense; TGATCGGAATCTTCAACCGGCAGCT
>probe:Drosophila_2:1640759_at:639:289; Interrogation_Position=647; Antisense; GACAAATTCAAATCCGGAGGTTCCA
>probe:Drosophila_2:1640759_at:589:435; Interrogation_Position=663; Antisense; GAGGTTCCAGATGTCGGAGGCAAAT
>probe:Drosophila_2:1640759_at:85:83; Interrogation_Position=699; Antisense; AGGGAATGCCCATGATTAGAATCAA
>probe:Drosophila_2:1640759_at:651:533; Interrogation_Position=780; Antisense; GGAAAGTTTTCCTTACTACACATAT
>probe:Drosophila_2:1640759_at:130:705; Interrogation_Position=843; Antisense; TTAAATTCCATTTTCAACGGCAATT
>probe:Drosophila_2:1640759_at:183:493; Interrogation_Position=900; Antisense; GTCAGAGGCCACTCAAAAATTTGGT
>probe:Drosophila_2:1640759_at:444:479; Interrogation_Position=929; Antisense; GTTTCTGATCTTTTTTCAAGCCGAT

Paste this into a BLAST search page for me
ATGGACTTACTACAGGGAACAGGGACAGGGAACCAAATGCATTGTCAGTAACCAATGGGCGGTATTATTTAAGCTAATATCGTTCAAAATCCCAGTCGGAATCCCAGTCGGAATGGTCAGAACCAGAACCAACAGGTCGAAGACGGCAATTGATCGGAATCTTCAACCGGCAGCTGACAAATTCAAATCCGGAGGTTCCAGAGGTTCCAGATGTCGGAGGCAAATAGGGAATGCCCATGATTAGAATCAAGGAAAGTTTTCCTTACTACACATATTTAAATTCCATTTTCAACGGCAATTGTCAGAGGCCACTCAAAAATTTGGTGTTTCTGATCTTTTTTCAAGCCGAT

Full Affymetrix probeset data:

Annotations for 1640759_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720