FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640760_at:

>probe:Drosophila_2:1640760_at:244:377; Interrogation_Position=2589; Antisense; GAAGAATCTCGTCATTGGCAATCGA
>probe:Drosophila_2:1640760_at:634:655; Interrogation_Position=2631; Antisense; TAATCAATCATCACACATCCCGCAT
>probe:Drosophila_2:1640760_at:652:45; Interrogation_Position=2647; Antisense; ATCCCGCATCTTTCAAGCATCAAAA
>probe:Drosophila_2:1640760_at:8:455; Interrogation_Position=2684; Antisense; GATCAGATCAGTTCAGTTCAGCCTC
>probe:Drosophila_2:1640760_at:488:473; Interrogation_Position=2699; Antisense; GTTCAGCCTCTGAAAGTCCTTGCAA
>probe:Drosophila_2:1640760_at:196:549; Interrogation_Position=2743; Antisense; GGAGTGTACGACCACACACTTATAG
>probe:Drosophila_2:1640760_at:346:219; Interrogation_Position=2785; Antisense; AAGTCTTTCAAGTACAGCGCTCTGT
>probe:Drosophila_2:1640760_at:549:405; Interrogation_Position=2843; Antisense; GACGATCCTTTTTATTACACTGCCC
>probe:Drosophila_2:1640760_at:275:279; Interrogation_Position=2880; Antisense; CTACCCATCAGTGTTCCATGTTTCA
>probe:Drosophila_2:1640760_at:15:307; Interrogation_Position=2895; Antisense; CCATGTTTCATGTGTCAGGCGATAA
>probe:Drosophila_2:1640760_at:703:707; Interrogation_Position=3012; Antisense; TTAACATCATAGTCACACACCCCAA
>probe:Drosophila_2:1640760_at:50:599; Interrogation_Position=3055; Antisense; TGTAACAAGTCCTAAGTCGTCCCTG
>probe:Drosophila_2:1640760_at:115:293; Interrogation_Position=3072; Antisense; CGTCCCTGGCGTTATGTCGAGTTAA
>probe:Drosophila_2:1640760_at:301:377; Interrogation_Position=3087; Antisense; GTCGAGTTAACACAATTTCCCGATT

Paste this into a BLAST search page for me
GAAGAATCTCGTCATTGGCAATCGATAATCAATCATCACACATCCCGCATATCCCGCATCTTTCAAGCATCAAAAGATCAGATCAGTTCAGTTCAGCCTCGTTCAGCCTCTGAAAGTCCTTGCAAGGAGTGTACGACCACACACTTATAGAAGTCTTTCAAGTACAGCGCTCTGTGACGATCCTTTTTATTACACTGCCCCTACCCATCAGTGTTCCATGTTTCACCATGTTTCATGTGTCAGGCGATAATTAACATCATAGTCACACACCCCAATGTAACAAGTCCTAAGTCGTCCCTGCGTCCCTGGCGTTATGTCGAGTTAAGTCGAGTTAACACAATTTCCCGATT

Full Affymetrix probeset data:

Annotations for 1640760_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720