FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640761_at:

>probe:Drosophila_2:1640761_at:284:129; Interrogation_Position=158; Antisense; ACCATTTCAGCTGTCGGCGAGTCCA
>probe:Drosophila_2:1640761_at:66:351; Interrogation_Position=230; Antisense; GCAGATGCCGCCGAACGTATTCGAA
>probe:Drosophila_2:1640761_at:108:245; Interrogation_Position=309; Antisense; AATTCGAATTCCTGAACGCGTGCTT
>probe:Drosophila_2:1640761_at:186:79; Interrogation_Position=366; Antisense; AGGTACATGAACTGCGCACCGTCAG
>probe:Drosophila_2:1640761_at:427:327; Interrogation_Position=390; Antisense; GCGATGTTATCGCTTTCTACCAAAC
>probe:Drosophila_2:1640761_at:131:627; Interrogation_Position=432; Antisense; TGCCGTTTGATGCACTGAAGCGCAT
>probe:Drosophila_2:1640761_at:54:421; Interrogation_Position=467; Antisense; GAGAATTTGCACATCCAGTACGAGT
>probe:Drosophila_2:1640761_at:563:89; Interrogation_Position=483; Antisense; AGTACGAGTACGTGCGATTCCATCC
>probe:Drosophila_2:1640761_at:314:463; Interrogation_Position=498; Antisense; GATTCCATCCCGAGACAGATACCAA
>probe:Drosophila_2:1640761_at:331:531; Interrogation_Position=530; Antisense; GGCAAAACGGCTTTCCCCAAGAGCT
>probe:Drosophila_2:1640761_at:675:489; Interrogation_Position=563; Antisense; GTCACCGGTCTCAAGTACCGTGGAA
>probe:Drosophila_2:1640761_at:238:311; Interrogation_Position=606; Antisense; CCAAGCGATCCTGGCCTTAGAAACA
>probe:Drosophila_2:1640761_at:638:13; Interrogation_Position=662; Antisense; ATTAAATGCATTCTGGAAGCCCGAG
>probe:Drosophila_2:1640761_at:510:379; Interrogation_Position=677; Antisense; GAAGCCCGAGATTTACGTCATATAT

Paste this into a BLAST search page for me
ACCATTTCAGCTGTCGGCGAGTCCAGCAGATGCCGCCGAACGTATTCGAAAATTCGAATTCCTGAACGCGTGCTTAGGTACATGAACTGCGCACCGTCAGGCGATGTTATCGCTTTCTACCAAACTGCCGTTTGATGCACTGAAGCGCATGAGAATTTGCACATCCAGTACGAGTAGTACGAGTACGTGCGATTCCATCCGATTCCATCCCGAGACAGATACCAAGGCAAAACGGCTTTCCCCAAGAGCTGTCACCGGTCTCAAGTACCGTGGAACCAAGCGATCCTGGCCTTAGAAACAATTAAATGCATTCTGGAAGCCCGAGGAAGCCCGAGATTTACGTCATATAT

Full Affymetrix probeset data:

Annotations for 1640761_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720