FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640762_at:

>probe:Drosophila_2:1640762_at:496:557; Interrogation_Position=202; Antisense; GGAAATATTCGCTCAAACGGTCTGG
>probe:Drosophila_2:1640762_at:478:197; Interrogation_Position=217; Antisense; AACGGTCTGGACATATGCGACTGTA
>probe:Drosophila_2:1640762_at:642:441; Interrogation_Position=256; Antisense; GATGGTTGCTGGTATAATTGCCGAA
>probe:Drosophila_2:1640762_at:89:247; Interrogation_Position=271; Antisense; AATTGCCGAAGTTGTGGCTCTACCA
>probe:Drosophila_2:1640762_at:135:217; Interrogation_Position=279; Antisense; AAGTTGTGGCTCTACCAGGTGTGGT
>probe:Drosophila_2:1640762_at:476:673; Interrogation_Position=291; Antisense; TACCAGGTGTGGTCCCCAATGTCGC
>probe:Drosophila_2:1640762_at:429:631; Interrogation_Position=303; Antisense; TCCCCAATGTCGCTCGAATCGAAAG
>probe:Drosophila_2:1640762_at:322:643; Interrogation_Position=34; Antisense; TCTCGCCAAGATATGAAGCCGTATT
>probe:Drosophila_2:1640762_at:96:689; Interrogation_Position=446; Antisense; TATTAATGAACAGCCAAACGAGCAT
>probe:Drosophila_2:1640762_at:586:419; Interrogation_Position=465; Antisense; GAGCATTAAACTATCATTCAGACGA
>probe:Drosophila_2:1640762_at:237:217; Interrogation_Position=578; Antisense; AAGTAAATTCTTCAGCAGCTATGGT
>probe:Drosophila_2:1640762_at:500:113; Interrogation_Position=591; Antisense; AGCAGCTATGGTGAAGACTTATTGT
>probe:Drosophila_2:1640762_at:345:463; Interrogation_Position=61; Antisense; GATTCAGATTATTCCATCAGTCGCA
>probe:Drosophila_2:1640762_at:89:703; Interrogation_Position=69; Antisense; TTATTCCATCAGTCGCAATTTGCGT

Paste this into a BLAST search page for me
GGAAATATTCGCTCAAACGGTCTGGAACGGTCTGGACATATGCGACTGTAGATGGTTGCTGGTATAATTGCCGAAAATTGCCGAAGTTGTGGCTCTACCAAAGTTGTGGCTCTACCAGGTGTGGTTACCAGGTGTGGTCCCCAATGTCGCTCCCCAATGTCGCTCGAATCGAAAGTCTCGCCAAGATATGAAGCCGTATTTATTAATGAACAGCCAAACGAGCATGAGCATTAAACTATCATTCAGACGAAAGTAAATTCTTCAGCAGCTATGGTAGCAGCTATGGTGAAGACTTATTGTGATTCAGATTATTCCATCAGTCGCATTATTCCATCAGTCGCAATTTGCGT

Full Affymetrix probeset data:

Annotations for 1640762_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720