FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640763_at:

>probe:Drosophila_2:1640763_at:308:513; Interrogation_Position=1559; Antisense; GTGATCATAAGAGACTGCCCCAGTT
>probe:Drosophila_2:1640763_at:343:319; Interrogation_Position=1575; Antisense; GCCCCAGTTGGGTATTAGCACGCGA
>probe:Drosophila_2:1640763_at:294:221; Interrogation_Position=1754; Antisense; AAGTGGACACTACAGCCGAGGTCGC
>probe:Drosophila_2:1640763_at:403:507; Interrogation_Position=1813; Antisense; GTGCTCCTTCATTGCCATATTTAGT
>probe:Drosophila_2:1640763_at:305:15; Interrogation_Position=1831; Antisense; ATTTAGTAGATCCTCAACGCCGAAG
>probe:Drosophila_2:1640763_at:157:95; Interrogation_Position=1857; Antisense; AGATCCAGGTTTCACACTGGTTCCG
>probe:Drosophila_2:1640763_at:607:325; Interrogation_Position=1881; Antisense; GCGACCGTGACACCATATTGCGGAT
>probe:Drosophila_2:1640763_at:151:695; Interrogation_Position=1919; Antisense; TTTCGCTGGACTATCTTGTGTTTGG
>probe:Drosophila_2:1640763_at:598:95; Interrogation_Position=1955; Antisense; AGAGCCTCCACGATTACTTCGGCGA
>probe:Drosophila_2:1640763_at:30:497; Interrogation_Position=2024; Antisense; GTCAGAGTAGTCACGCAGGCCAAAG
>probe:Drosophila_2:1640763_at:67:443; Interrogation_Position=2059; Antisense; GATGTTTTCATTGGACTGGTGCGTC
>probe:Drosophila_2:1640763_at:487:591; Interrogation_Position=2075; Antisense; TGGTGCGTCTCTAGCAATTGCTTTA
>probe:Drosophila_2:1640763_at:538:341; Interrogation_Position=2094; Antisense; GCTTTATTATAGGAGCCACGCCCTG
>probe:Drosophila_2:1640763_at:92:135; Interrogation_Position=2111; Antisense; ACGCCCTGCTGTACTATATGTGACT

Paste this into a BLAST search page for me
GTGATCATAAGAGACTGCCCCAGTTGCCCCAGTTGGGTATTAGCACGCGAAAGTGGACACTACAGCCGAGGTCGCGTGCTCCTTCATTGCCATATTTAGTATTTAGTAGATCCTCAACGCCGAAGAGATCCAGGTTTCACACTGGTTCCGGCGACCGTGACACCATATTGCGGATTTTCGCTGGACTATCTTGTGTTTGGAGAGCCTCCACGATTACTTCGGCGAGTCAGAGTAGTCACGCAGGCCAAAGGATGTTTTCATTGGACTGGTGCGTCTGGTGCGTCTCTAGCAATTGCTTTAGCTTTATTATAGGAGCCACGCCCTGACGCCCTGCTGTACTATATGTGACT

Full Affymetrix probeset data:

Annotations for 1640763_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720