Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640764_at:

>probe:Drosophila_2:1640764_at:174:5; Interrogation_Position=6228; Antisense; ATTAGCCTACAGTTTCGTATTTGGT
>probe:Drosophila_2:1640764_at:244:95; Interrogation_Position=6338; Antisense; AGTTGCAATTCTCGAACTGTATTCG
>probe:Drosophila_2:1640764_at:134:325; Interrogation_Position=6368; Antisense; GCGAATCTATTTCTTTGCACAACCC
>probe:Drosophila_2:1640764_at:618:705; Interrogation_Position=6378; Antisense; TTCTTTGCACAACCCACTGTATGAA
>probe:Drosophila_2:1640764_at:238:479; Interrogation_Position=6406; Antisense; GTTTACTAACTGGAAGACTCTTGTC
>probe:Drosophila_2:1640764_at:569:143; Interrogation_Position=6422; Antisense; ACTCTTGTCACTCTTCTGCAAAGTA
>probe:Drosophila_2:1640764_at:168:23; Interrogation_Position=6464; Antisense; ATATCCCTATTCTTATTTTGCCTAA
>probe:Drosophila_2:1640764_at:549:179; Interrogation_Position=6526; Antisense; AAAACAAGCCAACGTCAGACACTAT
>probe:Drosophila_2:1640764_at:216:399; Interrogation_Position=6543; Antisense; GACACTATTTGTAGCGTTTTCCATA
>probe:Drosophila_2:1640764_at:590:599; Interrogation_Position=6552; Antisense; TGTAGCGTTTTCCATATACCCTTTA
>probe:Drosophila_2:1640764_at:415:707; Interrogation_Position=6586; Antisense; TTAACCCGATCAGTTGTTTTCGCCT
>probe:Drosophila_2:1640764_at:258:603; Interrogation_Position=6600; Antisense; TGTTTTCGCCTGCACACAAATGTTA
>probe:Drosophila_2:1640764_at:728:115; Interrogation_Position=6632; Antisense; AGCATAAGAATGCAGGCACCCACCC
>probe:Drosophila_2:1640764_at:119:271; Interrogation_Position=6676; Antisense; CATATATATTTTTACGTCCGACACA

Paste this into a BLAST search page for me
ATTAGCCTACAGTTTCGTATTTGGTAGTTGCAATTCTCGAACTGTATTCGGCGAATCTATTTCTTTGCACAACCCTTCTTTGCACAACCCACTGTATGAAGTTTACTAACTGGAAGACTCTTGTCACTCTTGTCACTCTTCTGCAAAGTAATATCCCTATTCTTATTTTGCCTAAAAAACAAGCCAACGTCAGACACTATGACACTATTTGTAGCGTTTTCCATATGTAGCGTTTTCCATATACCCTTTATTAACCCGATCAGTTGTTTTCGCCTTGTTTTCGCCTGCACACAAATGTTAAGCATAAGAATGCAGGCACCCACCCCATATATATTTTTACGTCCGACACA

Full Affymetrix probeset data:

Annotations for 1640764_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime