FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640765_at:

>probe:Drosophila_2:1640765_at:194:273; Interrogation_Position=1017; Antisense; CTTGTGGCAATTGGTCGCATTCCGC
>probe:Drosophila_2:1640765_at:393:333; Interrogation_Position=1073; Antisense; GCTGGACAATCACCCGAACATACGG
>probe:Drosophila_2:1640765_at:154:385; Interrogation_Position=1088; Antisense; GAACATACGGCACGTGCTCTTCATC
>probe:Drosophila_2:1640765_at:294:91; Interrogation_Position=1135; Antisense; AGTTCCTGTTCATAGACCAGCGTGC
>probe:Drosophila_2:1640765_at:129:639; Interrogation_Position=1165; Antisense; TCGTGATTGGTTTCCTGCCTCAGGA
>probe:Drosophila_2:1640765_at:536:633; Interrogation_Position=1195; Antisense; TCGGCACCAGCTTCTACGAGTACTT
>probe:Drosophila_2:1640765_at:286:45; Interrogation_Position=1233; Antisense; ATCGCTGCGCTGATGGAGTCTCACA
>probe:Drosophila_2:1640765_at:63:171; Interrogation_Position=1280; Antisense; AAAGGTGACCACTCAGGTCTACCGC
>probe:Drosophila_2:1640765_at:120:671; Interrogation_Position=1299; Antisense; TACCGCTTCCGGTGCAAGGACAACA
>probe:Drosophila_2:1640765_at:112:45; Interrogation_Position=1363; Antisense; ATCCCTGGACGAGCGAGATTGACTA
>probe:Drosophila_2:1640765_at:20:23; Interrogation_Position=1387; Antisense; ATATAATCGCCAAGAATTCCGTGTT
>probe:Drosophila_2:1640765_at:137:171; Interrogation_Position=1491; Antisense; AAAGATCTTCATCCGCATCGAGTTG
>probe:Drosophila_2:1640765_at:229:577; Interrogation_Position=1518; Antisense; GGCGCCGGCGTTTGAAATTCCATAT
>probe:Drosophila_2:1640765_at:353:31; Interrogation_Position=1567; Antisense; ATAAGCCCATCATTTTTGTACCGCC

Paste this into a BLAST search page for me
CTTGTGGCAATTGGTCGCATTCCGCGCTGGACAATCACCCGAACATACGGGAACATACGGCACGTGCTCTTCATCAGTTCCTGTTCATAGACCAGCGTGCTCGTGATTGGTTTCCTGCCTCAGGATCGGCACCAGCTTCTACGAGTACTTATCGCTGCGCTGATGGAGTCTCACAAAAGGTGACCACTCAGGTCTACCGCTACCGCTTCCGGTGCAAGGACAACAATCCCTGGACGAGCGAGATTGACTAATATAATCGCCAAGAATTCCGTGTTAAAGATCTTCATCCGCATCGAGTTGGGCGCCGGCGTTTGAAATTCCATATATAAGCCCATCATTTTTGTACCGCC

Full Affymetrix probeset data:

Annotations for 1640765_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720