Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640766_at:

>probe:Drosophila_2:1640766_at:670:537; Interrogation_Position=4849; Antisense; GGTATGTCCTTTGAGACAGCCCTAG
>probe:Drosophila_2:1640766_at:242:399; Interrogation_Position=4863; Antisense; GACAGCCCTAGCCAAATACCGAAAG
>probe:Drosophila_2:1640766_at:695:383; Interrogation_Position=4944; Antisense; GAACTCCGCAATTTTATGCCTGCAG
>probe:Drosophila_2:1640766_at:331:355; Interrogation_Position=4969; Antisense; GCACCGTCCAATTCATCGGATGTAT
>probe:Drosophila_2:1640766_at:716:17; Interrogation_Position=5009; Antisense; ATTTGCAAATCTACCGACCCAATAC
>probe:Drosophila_2:1640766_at:488:29; Interrogation_Position=5030; Antisense; ATACAGGTCCCCAAGTGCGATTGGA
>probe:Drosophila_2:1640766_at:511:49; Interrogation_Position=5060; Antisense; ATGCCTCCATTTCATCACGATATGT
>probe:Drosophila_2:1640766_at:319:491; Interrogation_Position=5089; Antisense; GTAAGCCCGGAGGAGGCCCAAACAT
>probe:Drosophila_2:1640766_at:672:23; Interrogation_Position=5144; Antisense; ATATGTGCTCACACCTCTACTGGAA
>probe:Drosophila_2:1640766_at:677:483; Interrogation_Position=5200; Antisense; GTAGGACTCCGAATGCGTACCTATC
>probe:Drosophila_2:1640766_at:688:651; Interrogation_Position=5221; Antisense; TATCACGTGCTCTCCGGGTTAATGC
>probe:Drosophila_2:1640766_at:553:457; Interrogation_Position=5250; Antisense; GATTTGGGACCGGATCGAACTCATT
>probe:Drosophila_2:1640766_at:459:669; Interrogation_Position=5365; Antisense; TACGATGACCTGGTGGCCGATTTGT
>probe:Drosophila_2:1640766_at:203:543; Interrogation_Position=5394; Antisense; GGATTCCCTCGTGGAGAGCCATTAA

Paste this into a BLAST search page for me
GGTATGTCCTTTGAGACAGCCCTAGGACAGCCCTAGCCAAATACCGAAAGGAACTCCGCAATTTTATGCCTGCAGGCACCGTCCAATTCATCGGATGTATATTTGCAAATCTACCGACCCAATACATACAGGTCCCCAAGTGCGATTGGAATGCCTCCATTTCATCACGATATGTGTAAGCCCGGAGGAGGCCCAAACATATATGTGCTCACACCTCTACTGGAAGTAGGACTCCGAATGCGTACCTATCTATCACGTGCTCTCCGGGTTAATGCGATTTGGGACCGGATCGAACTCATTTACGATGACCTGGTGGCCGATTTGTGGATTCCCTCGTGGAGAGCCATTAA

Full Affymetrix probeset data:

Annotations for 1640766_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime