FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640768_at:

>probe:Drosophila_2:1640768_at:573:121; Interrogation_Position=105; Antisense; AGCGTCCCCAACAGATGGCGAAACG
>probe:Drosophila_2:1640768_at:228:583; Interrogation_Position=120; Antisense; TGGCGAAACGTCTCCAGTTACAGAA
>probe:Drosophila_2:1640768_at:417:475; Interrogation_Position=136; Antisense; GTTACAGAAGCCAGTTCCATCGGAG
>probe:Drosophila_2:1640768_at:138:531; Interrogation_Position=184; Antisense; GGGTCGGAGGTCACAGAATCACCAA
>probe:Drosophila_2:1640768_at:187:473; Interrogation_Position=226; Antisense; GTTAATAGCACGGACAACCCAGACC
>probe:Drosophila_2:1640768_at:395:141; Interrogation_Position=254; Antisense; ACGGCTCGCCTGACCCTGAAAATGG
>probe:Drosophila_2:1640768_at:450:549; Interrogation_Position=277; Antisense; GGAGGAGATCCATTTGTGAAGCCAG
>probe:Drosophila_2:1640768_at:230:529; Interrogation_Position=315; Antisense; GGGACCTCGACACGTTAGAGCACAT
>probe:Drosophila_2:1640768_at:442:677; Interrogation_Position=330; Antisense; TAGAGCACATGATGGCTTCCACAGC
>probe:Drosophila_2:1640768_at:337:569; Interrogation_Position=343; Antisense; GGCTTCCACAGCCTGAAGACGGAGA
>probe:Drosophila_2:1640768_at:392:207; Interrogation_Position=378; Antisense; AAGCTGGAACGATGCCTTTACCACG
>probe:Drosophila_2:1640768_at:92:45; Interrogation_Position=43; Antisense; ATCGCTATATTCTTGGTAGCCGCGC
>probe:Drosophila_2:1640768_at:241:487; Interrogation_Position=58; Antisense; GTAGCCGCGCTCGAGGCTCAGGAAA
>probe:Drosophila_2:1640768_at:239:265; Interrogation_Position=76; Antisense; CAGGAAACCCCTGCGGCTGAATCAT

Paste this into a BLAST search page for me
AGCGTCCCCAACAGATGGCGAAACGTGGCGAAACGTCTCCAGTTACAGAAGTTACAGAAGCCAGTTCCATCGGAGGGGTCGGAGGTCACAGAATCACCAAGTTAATAGCACGGACAACCCAGACCACGGCTCGCCTGACCCTGAAAATGGGGAGGAGATCCATTTGTGAAGCCAGGGGACCTCGACACGTTAGAGCACATTAGAGCACATGATGGCTTCCACAGCGGCTTCCACAGCCTGAAGACGGAGAAAGCTGGAACGATGCCTTTACCACGATCGCTATATTCTTGGTAGCCGCGCGTAGCCGCGCTCGAGGCTCAGGAAACAGGAAACCCCTGCGGCTGAATCAT

Full Affymetrix probeset data:

Annotations for 1640768_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720