Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640773_at:

>probe:Drosophila_2:1640773_at:294:543; Interrogation_Position=2821; Antisense; GGATCAAAGCCCCAGAGCGTGAGTC
>probe:Drosophila_2:1640773_at:606:291; Interrogation_Position=2838; Antisense; CGTGAGTCCAAAGCGCCTGATCTAT
>probe:Drosophila_2:1640773_at:542:605; Interrogation_Position=2855; Antisense; TGATCTATGGTGGACCCGCTGCAAC
>probe:Drosophila_2:1640773_at:172:643; Interrogation_Position=2883; Antisense; TCTCCTCTGTGCAACTGGCATCAAA
>probe:Drosophila_2:1640773_at:163:291; Interrogation_Position=2987; Antisense; CGGGCGCCTACTACGGCGAGATGAT
>probe:Drosophila_2:1640773_at:40:337; Interrogation_Position=3028; Antisense; GCTCCAGCGGCGGAATACAAGTTCC
>probe:Drosophila_2:1640773_at:376:649; Interrogation_Position=3062; Antisense; TCAGCGTGCAGAGACTGGCGCCGCA
>probe:Drosophila_2:1640773_at:725:623; Interrogation_Position=3101; Antisense; TGCGCGAGACGCAGGAACTCATAAA
>probe:Drosophila_2:1640773_at:457:193; Interrogation_Position=3116; Antisense; AACTCATAAAAGACTCGTGCCCGCA
>probe:Drosophila_2:1640773_at:555:261; Interrogation_Position=3189; Antisense; CAGCAGGAACCCCACTAGAACTAGA
>probe:Drosophila_2:1640773_at:175:675; Interrogation_Position=3204; Antisense; TAGAACTAGACCCACCCTGGAGACG
>probe:Drosophila_2:1640773_at:365:587; Interrogation_Position=3221; Antisense; TGGAGACGCAGTTCTCGCAGGAACT
>probe:Drosophila_2:1640773_at:344:349; Interrogation_Position=3237; Antisense; GCAGGAACTCTCGTGATATCTATAT
>probe:Drosophila_2:1640773_at:152:103; Interrogation_Position=3277; Antisense; AGACGGAGGATGCACCCACGTTCAG

Paste this into a BLAST search page for me
GGATCAAAGCCCCAGAGCGTGAGTCCGTGAGTCCAAAGCGCCTGATCTATTGATCTATGGTGGACCCGCTGCAACTCTCCTCTGTGCAACTGGCATCAAACGGGCGCCTACTACGGCGAGATGATGCTCCAGCGGCGGAATACAAGTTCCTCAGCGTGCAGAGACTGGCGCCGCATGCGCGAGACGCAGGAACTCATAAAAACTCATAAAAGACTCGTGCCCGCACAGCAGGAACCCCACTAGAACTAGATAGAACTAGACCCACCCTGGAGACGTGGAGACGCAGTTCTCGCAGGAACTGCAGGAACTCTCGTGATATCTATATAGACGGAGGATGCACCCACGTTCAG

Full Affymetrix probeset data:

Annotations for 1640773_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime