Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640775_a_at:

>probe:Drosophila_2:1640775_a_at:359:531; Interrogation_Position=1045; Antisense; GGTGGCCATGCTGATGCACAACACG
>probe:Drosophila_2:1640775_a_at:549:57; Interrogation_Position=1095; Antisense; ATGATCGCAAGTCCTCCTGAAGATT
>probe:Drosophila_2:1640775_a_at:269:463; Interrogation_Position=1116; Antisense; GATTCACCAGTAACTATCGTGCTTC
>probe:Drosophila_2:1640775_a_at:447:41; Interrogation_Position=1131; Antisense; ATCGTGCTTCGCTGGCCGAGAAATA
>probe:Drosophila_2:1640775_a_at:267:389; Interrogation_Position=665; Antisense; GAAACTCTCGGTCGTAACGCCGTTG
>probe:Drosophila_2:1640775_a_at:618:199; Interrogation_Position=680; Antisense; AACGCCGTTGTGGTGGGACGCTCCA
>probe:Drosophila_2:1640775_a_at:331:369; Interrogation_Position=706; Antisense; GAATGTCAGTCTACCGATGGCAATC
>probe:Drosophila_2:1640775_a_at:593:67; Interrogation_Position=722; Antisense; ATGGCAATCTTGCTGCACGCGGATG
>probe:Drosophila_2:1640775_a_at:455:361; Interrogation_Position=764; Antisense; GCAATGGATGCCACGGTGACCATCT
>probe:Drosophila_2:1640775_a_at:513:511; Interrogation_Position=779; Antisense; GTGACCATCTGCCACAGGTATACAC
>probe:Drosophila_2:1640775_a_at:258:321; Interrogation_Position=828; Antisense; GCCGCCAAGCGGATATCATTGTGGT
>probe:Drosophila_2:1640775_a_at:117:203; Interrogation_Position=863; Antisense; AAGCCGGGTTTGATCACCAAGGACA
>probe:Drosophila_2:1640775_a_at:634:555; Interrogation_Position=883; Antisense; GGACATGGTTAAGCCCGGAGCCTGT
>probe:Drosophila_2:1640775_a_at:185:687; Interrogation_Position=980; Antisense; TTTGAAGAAGTTCGCCAGGTCGCCG

Paste this into a BLAST search page for me
GGTGGCCATGCTGATGCACAACACGATGATCGCAAGTCCTCCTGAAGATTGATTCACCAGTAACTATCGTGCTTCATCGTGCTTCGCTGGCCGAGAAATAGAAACTCTCGGTCGTAACGCCGTTGAACGCCGTTGTGGTGGGACGCTCCAGAATGTCAGTCTACCGATGGCAATCATGGCAATCTTGCTGCACGCGGATGGCAATGGATGCCACGGTGACCATCTGTGACCATCTGCCACAGGTATACACGCCGCCAAGCGGATATCATTGTGGTAAGCCGGGTTTGATCACCAAGGACAGGACATGGTTAAGCCCGGAGCCTGTTTTGAAGAAGTTCGCCAGGTCGCCG

Full Affymetrix probeset data:

Annotations for 1640775_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime