FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640776_at:

>probe:Drosophila_2:1640776_at:93:347; Interrogation_Position=486; Antisense; GCATCCTGCCCCTGAGTTAAAAATG
>probe:Drosophila_2:1640776_at:298:645; Interrogation_Position=530; Antisense; TTTGGCGAGTACTGGACTCCCTTAC
>probe:Drosophila_2:1640776_at:682:699; Interrogation_Position=551; Antisense; TTACTGACCCACCTAAAAGATCGGA
>probe:Drosophila_2:1640776_at:28:473; Interrogation_Position=583; Antisense; GTTCTCCAGAGCGATTACACAAGTC
>probe:Drosophila_2:1640776_at:146:161; Interrogation_Position=601; Antisense; ACAAGTCGTTTGAGCCTGGTGACCC
>probe:Drosophila_2:1640776_at:288:317; Interrogation_Position=614; Antisense; GCCTGGTGACCCATTTAAGTCTGCA
>probe:Drosophila_2:1640776_at:279:381; Interrogation_Position=643; Antisense; GAACGACGAGCTCCCCGATTTGTGA
>probe:Drosophila_2:1640776_at:503:19; Interrogation_Position=660; Antisense; ATTTGTGATTCCATCTACACGGCGC
>probe:Drosophila_2:1640776_at:203:665; Interrogation_Position=675; Antisense; TACACGGCGCCATGTGACTTTTTCG
>probe:Drosophila_2:1640776_at:455:401; Interrogation_Position=690; Antisense; GACTTTTTCGCCCAGCACTTTGGAA
>probe:Drosophila_2:1640776_at:150:579; Interrogation_Position=756; Antisense; GGCCTTCCAGAATTTCGTGCGTGAA
>probe:Drosophila_2:1640776_at:649:569; Interrogation_Position=790; Antisense; GGCTATTACCAACTATTACTCTCAC
>probe:Drosophila_2:1640776_at:170:101; Interrogation_Position=818; Antisense; AGAGAGAGCTAACCGGCTTTCAGCC
>probe:Drosophila_2:1640776_at:608:545; Interrogation_Position=954; Antisense; GGATCTGGCTATGATGGCACTCCAT

Paste this into a BLAST search page for me
GCATCCTGCCCCTGAGTTAAAAATGTTTGGCGAGTACTGGACTCCCTTACTTACTGACCCACCTAAAAGATCGGAGTTCTCCAGAGCGATTACACAAGTCACAAGTCGTTTGAGCCTGGTGACCCGCCTGGTGACCCATTTAAGTCTGCAGAACGACGAGCTCCCCGATTTGTGAATTTGTGATTCCATCTACACGGCGCTACACGGCGCCATGTGACTTTTTCGGACTTTTTCGCCCAGCACTTTGGAAGGCCTTCCAGAATTTCGTGCGTGAAGGCTATTACCAACTATTACTCTCACAGAGAGAGCTAACCGGCTTTCAGCCGGATCTGGCTATGATGGCACTCCAT

Full Affymetrix probeset data:

Annotations for 1640776_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720