FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640777_at:

>probe:Drosophila_2:1640777_at:27:13; Interrogation_Position=1417; Antisense; ATTACTGTTTCGTCTTCGGAAGATG
>probe:Drosophila_2:1640777_at:452:563; Interrogation_Position=1434; Antisense; GGAAGATGCAGCGATCTCCGACCTG
>probe:Drosophila_2:1640777_at:17:105; Interrogation_Position=1467; Antisense; AGACGAGAAGTCTACCCTTTCTAGA
>probe:Drosophila_2:1640777_at:635:611; Interrogation_Position=1500; Antisense; TGACAAGAGGACCACGGCACTCGTG
>probe:Drosophila_2:1640777_at:218:551; Interrogation_Position=1527; Antisense; GGAGATCCCTTTCGACAATACCAAG
>probe:Drosophila_2:1640777_at:535:211; Interrogation_Position=1562; Antisense; AAGACCGATCATTATGCTCGCAGCC
>probe:Drosophila_2:1640777_at:730:233; Interrogation_Position=1603; Antisense; AATGCGCAGAGTGAGCCGTCATCGA
>probe:Drosophila_2:1640777_at:116:389; Interrogation_Position=1648; Antisense; GAAAACAAAGCACGGCTGTCGCCAT
>probe:Drosophila_2:1640777_at:222:257; Interrogation_Position=1753; Antisense; CAAATCGAGGTTCTGCACAATCTGC
>probe:Drosophila_2:1640777_at:362:649; Interrogation_Position=1800; Antisense; TCAGCGACGCTCAGAAGACATGGAT
>probe:Drosophila_2:1640777_at:197:441; Interrogation_Position=1834; Antisense; GATGGAAAAGCCCTTCATGCAACAG
>probe:Drosophila_2:1640777_at:563:187; Interrogation_Position=1878; Antisense; AACACAGCCGCTTATTAGTCGAACA
>probe:Drosophila_2:1640777_at:13:15; Interrogation_Position=1891; Antisense; ATTAGTCGAACAAGATCCGCCTCTA
>probe:Drosophila_2:1640777_at:297:213; Interrogation_Position=1978; Antisense; AAGACGCTCTTGGAGTTGCGATCTG

Paste this into a BLAST search page for me
ATTACTGTTTCGTCTTCGGAAGATGGGAAGATGCAGCGATCTCCGACCTGAGACGAGAAGTCTACCCTTTCTAGATGACAAGAGGACCACGGCACTCGTGGGAGATCCCTTTCGACAATACCAAGAAGACCGATCATTATGCTCGCAGCCAATGCGCAGAGTGAGCCGTCATCGAGAAAACAAAGCACGGCTGTCGCCATCAAATCGAGGTTCTGCACAATCTGCTCAGCGACGCTCAGAAGACATGGATGATGGAAAAGCCCTTCATGCAACAGAACACAGCCGCTTATTAGTCGAACAATTAGTCGAACAAGATCCGCCTCTAAAGACGCTCTTGGAGTTGCGATCTG

Full Affymetrix probeset data:

Annotations for 1640777_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720