Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640782_at:

>probe:Drosophila_2:1640782_at:264:171; Interrogation_Position=1497; Antisense; AAAGTGGCGCGTTAAGTGTCAGGAA
>probe:Drosophila_2:1640782_at:191:177; Interrogation_Position=1526; Antisense; AAACGGACACGCATGCATTGTACAT
>probe:Drosophila_2:1640782_at:325:107; Interrogation_Position=1575; Antisense; AGAACTCAAGAAGCGCCATGCCACT
>probe:Drosophila_2:1640782_at:247:259; Interrogation_Position=1596; Antisense; CACTGCCACAGCGAAGATACTTGAA
>probe:Drosophila_2:1640782_at:75:419; Interrogation_Position=1639; Antisense; GAGCTCAGTCATCGCATACTAAGGA
>probe:Drosophila_2:1640782_at:393:389; Interrogation_Position=1671; Antisense; GAAACAAGAGTGCACCCGCAAGGTG
>probe:Drosophila_2:1640782_at:614:547; Interrogation_Position=1716; Antisense; GGAGGAGGCCTTGCGCACCAAGCTA
>probe:Drosophila_2:1640782_at:148:665; Interrogation_Position=1739; Antisense; TACAGAACATGCTGGCTGTCGTCTC
>probe:Drosophila_2:1640782_at:28:241; Interrogation_Position=1825; Antisense; AATCAATTCGCAGCCAACGGTGGTG
>probe:Drosophila_2:1640782_at:111:519; Interrogation_Position=1844; Antisense; GTGGTGCCGAGTATGCCCTCGACAA
>probe:Drosophila_2:1640782_at:608:103; Interrogation_Position=1889; Antisense; AGACCTTTCTGACGATGCAGCAGCG
>probe:Drosophila_2:1640782_at:181:81; Interrogation_Position=1922; Antisense; AGGTGCTGAGCGATACCGTCAACAA
>probe:Drosophila_2:1640782_at:704:129; Interrogation_Position=1949; Antisense; ACCTGAGGGCGCTGGATGTTATAAT
>probe:Drosophila_2:1640782_at:448:243; Interrogation_Position=1971; Antisense; AATTAAAGGACTGCCCGAGCTGCGA

Paste this into a BLAST search page for me
AAAGTGGCGCGTTAAGTGTCAGGAAAAACGGACACGCATGCATTGTACATAGAACTCAAGAAGCGCCATGCCACTCACTGCCACAGCGAAGATACTTGAAGAGCTCAGTCATCGCATACTAAGGAGAAACAAGAGTGCACCCGCAAGGTGGGAGGAGGCCTTGCGCACCAAGCTATACAGAACATGCTGGCTGTCGTCTCAATCAATTCGCAGCCAACGGTGGTGGTGGTGCCGAGTATGCCCTCGACAAAGACCTTTCTGACGATGCAGCAGCGAGGTGCTGAGCGATACCGTCAACAAACCTGAGGGCGCTGGATGTTATAATAATTAAAGGACTGCCCGAGCTGCGA

Full Affymetrix probeset data:

Annotations for 1640782_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime