FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640784_at:

>probe:Drosophila_2:1640784_at:55:667; Interrogation_Position=199; Antisense; TACAGCGCCCTCATAGTGATGGCCA
>probe:Drosophila_2:1640784_at:619:607; Interrogation_Position=215; Antisense; TGATGGCCATCTGGAGCAGCTCCGA
>probe:Drosophila_2:1640784_at:550:337; Interrogation_Position=233; Antisense; GCTCCGAGAAGCGTTTGACCCTAAG
>probe:Drosophila_2:1640784_at:672:221; Interrogation_Position=268; Antisense; AAGTGGATCGCGGACAACTTCCCGT
>probe:Drosophila_2:1640784_at:35:103; Interrogation_Position=308; Antisense; AGAGCGTCTGGCAGAACTCGATCCG
>probe:Drosophila_2:1640784_at:446:449; Interrogation_Position=327; Antisense; GATCCGGCACAACCTGAGTCTCAAT
>probe:Drosophila_2:1640784_at:499:431; Interrogation_Position=342; Antisense; GAGTCTCAATCCGTTCTTCGTTCGG
>probe:Drosophila_2:1640784_at:456:417; Interrogation_Position=374; Antisense; GAGCTCTCGATGATCCTGGACGTGG
>probe:Drosophila_2:1640784_at:409:319; Interrogation_Position=424; Antisense; GCCGAGGATCTGTCCATTGGCGAGA
>probe:Drosophila_2:1640784_at:501:79; Interrogation_Position=510; Antisense; AGGTCATCCCTATCAGCGAATGCCA
>probe:Drosophila_2:1640784_at:402:533; Interrogation_Position=624; Antisense; GGTGCAGCACTACCAGGCCATGATG
>probe:Drosophila_2:1640784_at:353:631; Interrogation_Position=708; Antisense; TCCTCATTCTCATTTCATTCAGCAA
>probe:Drosophila_2:1640784_at:346:33; Interrogation_Position=732; Antisense; ATCAAAGCCCCTTCATATCCAGGAG
>probe:Drosophila_2:1640784_at:620:75; Interrogation_Position=752; Antisense; AGGAGCCATATCATCATACCCGCTA

Paste this into a BLAST search page for me
TACAGCGCCCTCATAGTGATGGCCATGATGGCCATCTGGAGCAGCTCCGAGCTCCGAGAAGCGTTTGACCCTAAGAAGTGGATCGCGGACAACTTCCCGTAGAGCGTCTGGCAGAACTCGATCCGGATCCGGCACAACCTGAGTCTCAATGAGTCTCAATCCGTTCTTCGTTCGGGAGCTCTCGATGATCCTGGACGTGGGCCGAGGATCTGTCCATTGGCGAGAAGGTCATCCCTATCAGCGAATGCCAGGTGCAGCACTACCAGGCCATGATGTCCTCATTCTCATTTCATTCAGCAAATCAAAGCCCCTTCATATCCAGGAGAGGAGCCATATCATCATACCCGCTA

Full Affymetrix probeset data:

Annotations for 1640784_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720