Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640791_at:

>probe:Drosophila_2:1640791_at:267:237; Interrogation_Position=2202; Antisense; AATCAATGGGTTCAGGTGGCCGCCA
>probe:Drosophila_2:1640791_at:111:309; Interrogation_Position=2224; Antisense; CCAGTTGAGCCTGCTCGAGATGCTG
>probe:Drosophila_2:1640791_at:334:425; Interrogation_Position=2240; Antisense; GAGATGCTGGACACCCATTATGAAA
>probe:Drosophila_2:1640791_at:67:705; Interrogation_Position=2257; Antisense; TTATGAAAAGGGTTCGGCCTCGAAG
>probe:Drosophila_2:1640791_at:510:99; Interrogation_Position=2280; Antisense; AGAGGCCACGAAAATCACCCAACTG
>probe:Drosophila_2:1640791_at:364:33; Interrogation_Position=2293; Antisense; ATCACCCAACTGCAGCAAGGCTGAG
>probe:Drosophila_2:1640791_at:307:283; Interrogation_Position=2313; Antisense; CTGAGGGTTCAGCAAAGAGTCGTAA
>probe:Drosophila_2:1640791_at:537:427; Interrogation_Position=2339; Antisense; GAGATCGATGTGACCGACAAGGACG
>probe:Drosophila_2:1640791_at:582:225; Interrogation_Position=2366; Antisense; AAGGACGATATTGTTGACTAGGTGA
>probe:Drosophila_2:1640791_at:106:403; Interrogation_Position=2381; Antisense; GACTAGGTGATATTGCACTACAGGA
>probe:Drosophila_2:1640791_at:279:617; Interrogation_Position=2394; Antisense; TGCACTACAGGATTGTTACTGCCCC
>probe:Drosophila_2:1640791_at:530:475; Interrogation_Position=2603; Antisense; GTTATATCATGCAAATCTAGCTTTT
>probe:Drosophila_2:1640791_at:656:255; Interrogation_Position=2614; Antisense; CAAATCTAGCTTTTATTATGCGAAA
>probe:Drosophila_2:1640791_at:694:477; Interrogation_Position=2688; Antisense; GTTTATTTTATTTGACCACAACAAG

Paste this into a BLAST search page for me
AATCAATGGGTTCAGGTGGCCGCCACCAGTTGAGCCTGCTCGAGATGCTGGAGATGCTGGACACCCATTATGAAATTATGAAAAGGGTTCGGCCTCGAAGAGAGGCCACGAAAATCACCCAACTGATCACCCAACTGCAGCAAGGCTGAGCTGAGGGTTCAGCAAAGAGTCGTAAGAGATCGATGTGACCGACAAGGACGAAGGACGATATTGTTGACTAGGTGAGACTAGGTGATATTGCACTACAGGATGCACTACAGGATTGTTACTGCCCCGTTATATCATGCAAATCTAGCTTTTCAAATCTAGCTTTTATTATGCGAAAGTTTATTTTATTTGACCACAACAAG

Full Affymetrix probeset data:

Annotations for 1640791_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime