FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640792_at:

>probe:Drosophila_2:1640792_at:459:131; Interrogation_Position=127; Antisense; ACCTGTTTGCTCGTCGTTTATTACA
>probe:Drosophila_2:1640792_at:245:561; Interrogation_Position=15; Antisense; GGAAAACCTAGACGCCACCATAGAT
>probe:Drosophila_2:1640792_at:504:467; Interrogation_Position=153; Antisense; GTTCTCAAAGGCCAACGGACCGCAG
>probe:Drosophila_2:1640792_at:665:515; Interrogation_Position=239; Antisense; GTGTCCAGGTGATCGAACGCACTCT
>probe:Drosophila_2:1640792_at:647:133; Interrogation_Position=283; Antisense; ACGAAATATGTCAGTCCCAGGGCCT
>probe:Drosophila_2:1640792_at:376:645; Interrogation_Position=317; Antisense; TCTTCGATCTCTACACAACCAATGA
>probe:Drosophila_2:1640792_at:92:369; Interrogation_Position=353; Antisense; GAATGCGATTTGCTTTCGAGGTCTA
>probe:Drosophila_2:1640792_at:12:227; Interrogation_Position=386; Antisense; AAGGCACTGGCGTTATTGATCGCGA
>probe:Drosophila_2:1640792_at:143:451; Interrogation_Position=403; Antisense; GATCGCGAGCAAGTTGGCACGGCTT
>probe:Drosophila_2:1640792_at:533:107; Interrogation_Position=47; Antisense; AGAACAGTCGGTTTGCAGCGCTCTA
>probe:Drosophila_2:1640792_at:560:555; Interrogation_Position=522; Antisense; GGACGGAGTCATTTCCTACGAGGAC
>probe:Drosophila_2:1640792_at:14:437; Interrogation_Position=541; Antisense; GAGGACTATTCTACTGTCGTGGAAC
>probe:Drosophila_2:1640792_at:689:121; Interrogation_Position=63; Antisense; AGCGCTCTACGGGAGTTTGATCAAG
>probe:Drosophila_2:1640792_at:423:659; Interrogation_Position=98; Antisense; TAACTTCGGAGTTGTCCCAGACGGA

Paste this into a BLAST search page for me
ACCTGTTTGCTCGTCGTTTATTACAGGAAAACCTAGACGCCACCATAGATGTTCTCAAAGGCCAACGGACCGCAGGTGTCCAGGTGATCGAACGCACTCTACGAAATATGTCAGTCCCAGGGCCTTCTTCGATCTCTACACAACCAATGAGAATGCGATTTGCTTTCGAGGTCTAAAGGCACTGGCGTTATTGATCGCGAGATCGCGAGCAAGTTGGCACGGCTTAGAACAGTCGGTTTGCAGCGCTCTAGGACGGAGTCATTTCCTACGAGGACGAGGACTATTCTACTGTCGTGGAACAGCGCTCTACGGGAGTTTGATCAAGTAACTTCGGAGTTGTCCCAGACGGA

Full Affymetrix probeset data:

Annotations for 1640792_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720