FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640793_at:

>probe:Drosophila_2:1640793_at:167:409; Interrogation_Position=308; Antisense; GACGACAGCCCCTTAAACAGGTCAT
>probe:Drosophila_2:1640793_at:507:127; Interrogation_Position=350; Antisense; ACCACTCCCTACAAGGTCAAGGTGA
>probe:Drosophila_2:1640793_at:655:493; Interrogation_Position=365; Antisense; GTCAAGGTGAAGTCGCAGCCAAAAA
>probe:Drosophila_2:1640793_at:3:183; Interrogation_Position=410; Antisense; AAAATCAGTGCATCGGATCAGTCCG
>probe:Drosophila_2:1640793_at:523:545; Interrogation_Position=424; Antisense; GGATCAGTCCGTCGACTACGAGGAA
>probe:Drosophila_2:1640793_at:219:719; Interrogation_Position=453; Antisense; TTGAGAACCTGGCACTTTACGAACC
>probe:Drosophila_2:1640793_at:464:101; Interrogation_Position=478; Antisense; AGAGCAGGTCATGTTCTCATCGTGC
>probe:Drosophila_2:1640793_at:575:231; Interrogation_Position=611; Antisense; AATGCTCTGCGCACCCAGAAGGACA
>probe:Drosophila_2:1640793_at:671:109; Interrogation_Position=627; Antisense; AGAAGGACAGCTCCCAGATCTTCGG
>probe:Drosophila_2:1640793_at:319:453; Interrogation_Position=643; Antisense; GATCTTCGGAGACTTTGTGGCCGAC
>probe:Drosophila_2:1640793_at:206:581; Interrogation_Position=660; Antisense; TGGCCGACCGGCTACGACAGTTGAA
>probe:Drosophila_2:1640793_at:605:133; Interrogation_Position=690; Antisense; ACGCCTCCGAGTTTGCCAAGGACAA
>probe:Drosophila_2:1640793_at:100:21; Interrogation_Position=728; Antisense; ATATTGGAGGCAGCGTCCATCGATC
>probe:Drosophila_2:1640793_at:56:449; Interrogation_Position=749; Antisense; GATCGGGCTCCCACTTATAATTAAA

Paste this into a BLAST search page for me
GACGACAGCCCCTTAAACAGGTCATACCACTCCCTACAAGGTCAAGGTGAGTCAAGGTGAAGTCGCAGCCAAAAAAAAATCAGTGCATCGGATCAGTCCGGGATCAGTCCGTCGACTACGAGGAATTGAGAACCTGGCACTTTACGAACCAGAGCAGGTCATGTTCTCATCGTGCAATGCTCTGCGCACCCAGAAGGACAAGAAGGACAGCTCCCAGATCTTCGGGATCTTCGGAGACTTTGTGGCCGACTGGCCGACCGGCTACGACAGTTGAAACGCCTCCGAGTTTGCCAAGGACAAATATTGGAGGCAGCGTCCATCGATCGATCGGGCTCCCACTTATAATTAAA

Full Affymetrix probeset data:

Annotations for 1640793_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720