FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640794_at:

>probe:Drosophila_2:1640794_at:37:611; Interrogation_Position=1278; Antisense; TGACCGTGCATGTGAGCGACTCCGA
>probe:Drosophila_2:1640794_at:201:667; Interrogation_Position=1315; Antisense; TTGCGTGGACGAGGACTACCTATCC
>probe:Drosophila_2:1640794_at:178:415; Interrogation_Position=1376; Antisense; GAGCGCGGCGCAGTTAACAACCCGA
>probe:Drosophila_2:1640794_at:519:225; Interrogation_Position=1412; Antisense; AAGGCACCCATTTCCATTATCGTAC
>probe:Drosophila_2:1640794_at:79:687; Interrogation_Position=1428; Antisense; TTATCGTACCGATCTATCGACGGGA
>probe:Drosophila_2:1640794_at:83:139; Interrogation_Position=1447; Antisense; ACGGGAGTGCTACAACGAGGTCTAC
>probe:Drosophila_2:1640794_at:523:433; Interrogation_Position=1496; Antisense; GAGGGCGTCTATTTGCTGAAGTTCG
>probe:Drosophila_2:1640794_at:224:189; Interrogation_Position=1523; Antisense; AACAGCTACAGCATCTGGCGCAATA
>probe:Drosophila_2:1640794_at:153:133; Interrogation_Position=1560; Antisense; ACCGCGTCTACTACGAGCGTTAAGA
>probe:Drosophila_2:1640794_at:716:51; Interrogation_Position=1617; Antisense; ATGAATCCTATCTCCGTACGAACGG
>probe:Drosophila_2:1640794_at:693:487; Interrogation_Position=1632; Antisense; GTACGAACGGCTAATGTGCAAGTCC
>probe:Drosophila_2:1640794_at:618:589; Interrogation_Position=1690; Antisense; TGGTTTTACGTGTGCGTTGCTGCAA
>probe:Drosophila_2:1640794_at:21:329; Interrogation_Position=1703; Antisense; GCGTTGCTGCAATTCCGGGAAACAA
>probe:Drosophila_2:1640794_at:661:413; Interrogation_Position=1740; Antisense; GACCATGCCGATTTCAGACTAAACC

Paste this into a BLAST search page for me
TGACCGTGCATGTGAGCGACTCCGATTGCGTGGACGAGGACTACCTATCCGAGCGCGGCGCAGTTAACAACCCGAAAGGCACCCATTTCCATTATCGTACTTATCGTACCGATCTATCGACGGGAACGGGAGTGCTACAACGAGGTCTACGAGGGCGTCTATTTGCTGAAGTTCGAACAGCTACAGCATCTGGCGCAATAACCGCGTCTACTACGAGCGTTAAGAATGAATCCTATCTCCGTACGAACGGGTACGAACGGCTAATGTGCAAGTCCTGGTTTTACGTGTGCGTTGCTGCAAGCGTTGCTGCAATTCCGGGAAACAAGACCATGCCGATTTCAGACTAAACC

Full Affymetrix probeset data:

Annotations for 1640794_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720